Mice

All of the experiments were performed in male and female mice aged 6–16 weeks. LSL-dCas9-SPH (dCas9-SPH, 031645) and Plxnb2flox/flox mice (036883) were obtained from The Jackson Laboratory. Alb-cre (003574), LSL-Cas9 (Cas9, 024858) and mT/mG mice (007576) were obtained from a local live mouse repository. LSL-dCas9-SPH mice were obtained in 2019 and initially exhibited spontaneous urination, as also reported on the Jackson Laboratory website. The phenotype disappeared when the mice were outcrossed to B6J mice and crossed with the Alb-cre strain. Chow and water were available ad libitum, unless specified otherwise. All of the mice were in the B6J background and maintained under a 12 h–12 h light–dark schedule. Mice were housed and bred under specific-pathogen-free conditions in accredited animal facilities. At the experimental end point, mice were euthanized by raising the CO2 concentrations. Approved humane end points (a palpable tumour with a diameter of more than 1.5 cm, or weight loss of more than 15%) were not exceeded. All of the experimental procedures were performed in accordance with Swiss Federal regulations and approved by the Cantonal Veterinary Office. Genotyping was performed by Transnetyx genotyping services.

Animal experiments

Hydrodynamic tail vein injection

Hydrodynamic injection, an efficient method to deliver nucleic acids to the liver, involves the rapid injection (6–8 s) of a large volume (8–12% body weight) of saline (0.9% sodium chloride) into the tail52. Mice were placed in a restraining device, and the tail was warmed with a red light lamp to induce lateral tail-vein dilatation. The injection site was cleaned and disinfected using an alcohol swab. Transposon plasmid (PT4-CMV-GFP (Addgene, 11704) or PT4-U6-sgRNA-CMV-GFP) and SB100X transposase OE plasmid pCMV(CAT)T7-SB100X (Addgene, 34879) were equilibrated at room temperature, transferred to a 3 ml syringe mounted with a 27 G needle, and then injected into the tail vein in a continuous motion. The mouse was removed from the restrainer and signs of recovery were monitored.

Intrasplenic injection of tumour cells followed by splenectomy

Intrasplenic injection of tumour cells followed by splenectomy was performed as previously described53. In brief, the mice were placed into a container connected to an oxygen–isoflurane inhalation device (4% for induction and 2–3% for maintenance). After 5 min, anaesthetized mice were placed onto a thermal pad (37 °C), isoflurane gas was continuously supplied by a nose cone and sterile eye ointment was applied to avoid corneal dehydration. Anaesthesia depth was monitored regularly by testing toe and tail pinch reflexes and by observing the rate, depth and pattern of respiration. All of the surgical instruments were sterilized before use and the surgical procedure was performed under aseptic conditions. The skin over the surgical site was shaved and disinfected with betadine. Using aseptic technique, an incision was made in the skin and peritoneal wall to expose the spleen. A sterile gauze was placed under the spleen. For each mouse, four 50 μl domes of AKPS organoids were collected, washed of Matrigel in ice-cold PBS and mechanically dissociated using a 20 G needle on a 20 ml syringe. Dissociated organoids were pelleted at 290g for 3 min, and resuspended in 0.04 ml sterile PBS and injected under the splenic capsule with an insulin syringe (BD, MicroFine, 0.3 ml, 30 G). Alternatively, 100,000 KPC cells in 0.04 ml sterile PBS were injected. After 10 min, the splenic artery and vein were closed by ligation. Immediately after, the spleen was resected. Subsequently, the wound was washed three times with sterile PBS. The peritoneal wall was closed with an absorbable polyglactin suture (Vicryl 4-0 or 5-0 coated) and the skin was closed with wound clips. The mice were monitored for weight loss and the experiment was terminated maximally 3 weeks after tumour cell injection.

Colonoscopy-guided submucosal injection of CRC organoids

The procedure for the colonoscopy-guided orthotopic injection of mouse colonic organoids was adapted from a previously published protocol54. At 36 h after passaging, AKPS or APTAK organoids were mechanically dissociated, resuspended in OptiMEM (Gibco) (one 50 μl Matrigel dome in 50 μl of OptiMEM per mouse for AKPS, three 50 μl Matrigel domes in 50 μl of OptiMEM per mouse for APTAK). Mice were anaesthetized by isoflurane inhalation and placed onto their back on a heating pad (37 °C). The colons were evacuated of stool with prewarmed PBS (37 °C) (Gibco) using the plastic tubing from an intravascular catheter (BD) mounted onto a 50 ml syringe (B. Braun). The organoid solution was injected with custom injection needles (33 gauge, 400 mm length, point style 4, 45° angle, Hamilton), a syringe (Hamilton) and a colonoscope with integrated working channel (Storz). The needle was brought into contact with colonic mucosa and 50 μl of organoid solution was quickly delivered to form a submucosal injection bubble. The mice were then monitored until the experimental or humane end point was reached.

Tail vein injection of AAV8

A 100 μl solution of 1 × 1011–2 × 1011 AAV viral genomes in sterile saline was loaded into a 1 ml syringe mounted with a 27 G needle. Mice were placed in a restraining device, and the tail was warmed with a red-light lamp to induce lateral tail-vein dilatation. The injection site was cleaned and disinfected using an alcohol swab, and then the AAV-containing solution was injected into the tail vein. The injections were performed 1 week before tumour inoculation for Plxnb2 overexpression, 2 weeks before or 5 days after tumour inoculation for Plxnb2 knockout, or 2 weeks after tumour inoculation for primary tumour experiments.

In vivo BLI

At 5 min before imaging, mice were injected intraperitoneally with luciferin substrate (d-luciferin, 150 mg per kg body weight in 0.15 ml PBS). During imaging on the Lumina S5 In Vivo Imaging System (IVIS, PerkinElmer), mice were anaesthetized with isoflurane and kept warm on a heated stage.

In vivo CRISPR-a screen

Library cloning

sgRNA sequences for dCas9-SPH-mediated OE were retrieved from the Caprano library55 and obtained as oPool from Integrated DNA Technologies with Gecko flanking sequences56. Three sgRNAs were selected per target from the Caprano Set A, for a total of 897 sgRNAs targeting 299 genes. One hundred safe-targeting sgRNAs11 were also included. The library (Supplementary Table 1) was cloned into the transposon vector PT4-CMV-GFP (Addgene, 117046) and amplified as described previously56. In brief, oPools were resuspended to 1 μg μl−1 in water and incubated for 2 h at 37 °C, then amplified by PCR (a list of the primer sequences is provided in Supplementary Table 3): 1 μl library (1 ng μl−1) was mixed with 12.5 μl NebNext MasterMix, 1.25 μl oligo reverse primer (10 μM), 1.25 μl oligo forward primer (10 μM) and 9 μl water and incubated in a thermocycler (98 °C for 30 s; 20 cycles of 98 °C for 10 s, 63 °C for 10 s, 72 °C for 12 s; then 72 °C for 2 min). The PCR products were purified using the Qiagen QIAquick PCR Purification Kit, eluted in 30 μl buffer EB (Qiagen) and separated on a 2% agarose gel in Tris-borate EDTA (TBE) buffer with SybrSafe Dye. The transposon vector was digested overnight with the Bsmb-v2 enzyme and run on a 2% agarose gel in TBE buffer with SybrSafe Dye. The 150 bp sgRNA amplicon and the digested vector band (missing 1,000 bp filler) were excised and gel-extracted using the QIAquick Gel Extraction Kit. Both the vector and insert were processed for isopropanol purification by incubating 50 μl eluted DNA with 50 μl isopropanol, 0.5 μl GlycoBlue Coprecipitant and 0.4 μl 5 M NaCl. The reactions were vortexed and incubated at room temperature for 15 min, before centrifugation at 16,000g for 15 min at room temperature. The precipitate was washed twice with 1 ml ice-cold 80% ethanol and air-dried for 1 min before resuspension in 10 μl water. The DNA concentration was measured using the NanoDrop system. The Gibson assembly reaction mix containing 10 μl MasterMix, 330 ng vector, 50 ng insert and water to 20 μl was incubated at 50 °C for 1 h. After a second isopropanol precipitation, the cloned transposon libraries were resuspended in 5 μl Tris-EDTA (TE) buffer and incubated at 55 °C for 10 min. The DNA concentration was measured using the NanoDrop system.

Library amplification

Escherichia coli electrocompetent bacteria (E. cloni; Biosearch Technologies) were thawed on ice for 20 min before addition of 1 μl of Gibson reaction and electroporation (1,800 V) in a MicroPulser Electroporator (Bio-Rad). A total of 975 μl of prewarmed recovery medium was added and the bacteria were incubated 37 °C at 250 rpm for 1 h. Bacteria were plated onto prewarmed 30 cm2 square agar plates with ampicillin and incubated overnight at 37 °C. The plates were scraped with 30–50 ml Luria–Bertani broth and plasmids were purified using the endotoxin-free MaxiPrep kit (Macherey-Nagel). Precipitated DNA was resuspended in 1 ml water and the concentration was measured using the NanoDrop system. pCMV(CAT)T7-SB100 (Addgene, 34879) was amplified in competent E. coli under chloramphenicol selection and purified using the Endotoxin-Free MaxiPrep kit (Macherey-Nagel).

Library delivery to mouse liver and tumour inoculation

The sgRNA transposon plasmid libraries (150 μg) and SB100X-encoding plasmids (50 μg) were co-injected hydrodynamically into Alb-cre;dCas9-SPH mice or littermate controls lacking Alb-cre. Then, 1 week later, dissociated AKPSsLP-mCherry organoids were inoculated by intrasplenic injection, followed by splenectomy. Metastases were allowed to grow for 2 weeks, during which several (10–100) small metastases (0.5–1.5 mm) formed.

Isolation of metastasis-distal and metastasis-proximal hepatocytes

Mice were euthanized by raising the CO2 concentrations, then the abdomen was opened and a G22 cannula was inserted into the inferior vena cava. The liver was perfused with 20 ml Hanks buffer (0.5 mM EDTA and 25 mM HEPES in HBSS) followed by 15 ml digestion buffer (15 mM HEPES and 32 μg ml−1 liberase (Roche) in low-glucose DMEM). After initial swelling of the liver, the portal vein was cut to allow outflow. After perfusion, the gallbladder was removed and the liver was transferred to a Petri dish with 10 ml digestion buffer and squished with a cell scraper to release the hepatocytes. Liberase was inactivated by adding 10 ml isolation buffer (10% fetal bovine serum (FBS) in low-glucose DMEM). The cell suspension was filtered through a 100 μm cell strainer and centrifuged at 50g for 2 min. The supernatant was removed and the pellet was washed again twice with 20 ml isolation buffer. Cells were resuspended in 2 ml FACS buffer (2 mM EDTA, 0.5% BSA in PBS) and stained with Zombie Violet (1:500) (BioLegend, 423113), TruStain FcX (anti-mouse CD16/32) antibody (BioLegend, 101320, 1:50), PE/Cy7 anti-mouse CD31 (BioLegend, 102418, 1:300) and BV570 anti-mouse CD45 (BioLegend, 103135, 1:300) for 25 min at 4 °C. Cells were washed and filtered through a 70 μm strainer. CD45CD31 hepatocytes that contained a sgRNA (GFP+), were divided into metastasis-proximal (mCherry+) and metastasis-distal (mCherry) by drawing different sorting gates on an AriaIII sorter (BD Biosciences) with 100 μm nozzle (the gating strategy is shown in the Supplementary Information). Cells were collected in PBS, centrifuged at 800g for 5 min and the pellet was stored at −20 °C.

Genomic DNA extraction and targeted guide amplification and sequencing

Genomic DNA extraction was performed as described in the ‘Isolation of genomic DNA with NucleoSpin Blood Kits and PCR pre-check’ protocol of the Broad Institute’s Genetic Perturbation Platform. In brief, the pellet was equilibrated at room temperature, resuspended in 200 μl PBS and incubated with proteinase K and lysis buffer mixture at 70 °C overnight. Then, 1 μl RNase A was added for 5 min at room temperature, followed by column purification using the NucleoSpin Blood Mini Kit (Macherey Nagel). DNA was eluted in 25 μl elution buffer (prewarmed at 70 °C), incubating on column for 5 min before centrifugation, then the concentration was measured using the NanoDrop system. sgRNAs were target amplified from both post-injection libraries and the plasmid library using an equimolar mixture of staggered P5 primers and P7 primers with sample-specific barcode (the sequences are provided in Supplementary Table 3) under the following conditions: 10 μl titanium buffer, 8 μl dNTPs, 5 μl DMSO, 0.5 μl P5 primer mix (100 μM), 40 μl water, 1.5 μl Titanium Taq polymerase, 25 μl DNA (maximum, 10 μg), 10 μl P7 primer (5 μM). The reactions were incubated in a thermocycler with the following programme: 95 °C for 5 min; 28 cycles of 95 °C for 30 s, 53 °C for 30 s and 72 °C for 20 s; and 72 °C for 10 min. PCR products from different samples were pooled according to the number of reads required to ensure 200–1,000 reads per sorted cell. After 1× SPRIselect bead (Beckman Coulter, B23319) purification, PCR products were eluted in 50 μl TE buffer. The quality and quantity of libraries were assessed using the dsDNA high-sensitivity kit (Life Technologies, Q32854) on the Qubit 4 fluorometer (Thermo Fisher Scientific) and using the high-sensitivity D1000 reagents and tapes (Agilent, 5067-5585, 5067-5584) on the TapeStation 4200 or Bioanalyzer (Agilent Technologies) system. Libraries were sequenced using the NextSeq kit (Illumina) with 75 bp single-end read chemistry and 9 bp index read, adding 10% PhiX spike-in (Illumina).

Replicates and coverage

The procedure outlined above (from cloning to sequencing) was repeated independently three times (three batches). In summary, the sgRNA coverage (that is, the number of sorted cells/997 sgRNAs) added up to a total of 1,000× for Alb-cre;dCas9-SPH mice (n = 7) and 500× for non-Cre littermate controls (n = 5).

Analysis

FASTQ files were demultiplexed using Bcl2fastq v.2.20.0.422 (Illumina) and adaptors were trimmed with cutadapt57 using the following parameters (-g CACCG and -a GTTTT). The sequences were aligned to the sgRNA library using Bowtie258,59. sgRNAs were counted using the MAGeCK count function (–norm-method total)60,61. sgRNA enrichment was calculated using the MAGeCK paired test function. Metastasis-proximal and metastasis-distal libraries from the same mouse were considered as paired samples. As sgRNAs in paired samples are considered to be independent sgRNAs (3 sgRNAs in 7 mice are thus considered to be 21 independent sgRNAs), paired testing yields consistent effects between paired replicates. This analysis was repeated for the individual library batches. The paired function was not used to compare perturbation enrichment in Alb-cre;dCas9-SPH versus non-Cre littermates, as an equal number of samples is required. Instead, sgRNA counts were added up from all Alb-cre;dCas9-SPH and non-Cre mice and then the standard MAGeCK RRA test function was applied. Results were visualized using MAGeCKFlute60 and ggplot262.

Spatial transcriptomics of human CRC liver metastases

Visium library preparation

A sample of human CRC hepatic metastasis (CB522586, 44 year old, male) with clear tumour-liver borders was selected from a commercial biobank (Origene). Non-consecutive sections were cut with a thickness of 10 μm and placed onto two capture areas of the 10x Visium Spatial Gene expression slide using the cryostat (Leica, CM3050S). The tissue optimization kit was used to determine the permeabilization times (24 min), and cDNA libraries were generated according to the manufacturer’s instructions (10x Genomics). The quality and quantity of libraries were assessed using the dsDNA high-sensitivity kit (Life Technologies, Q32854) on the Qubit 4 fluorometer (Thermo Fisher Scientific) and the high-sensitivity D1000 reagents and tapes (Agilent, 5067-5585, 5067-5584) on the TapeStation 4200 (Agilent Technologies) system. Paired-end sequencing was performed for all of the libraries (read 1:28 bp; index read: 10 bp; read 2: 82 bp) on the NovaSeq 6000 (Illumina) system using NovaSeq SP Reagent Kits (100 cycles).

Data analysis

Binary base call (BCL) files were demultiplexed using Bcl2fastq v.2.20.0.422 (Illumina) and preprocessed using Space Ranger (v.1.1.0 or v.1.2.0; 10x Genomics). Spot transcriptomes were deconvoluted with Spotlight63 using published scRNA-seq data as reference. Specifically, two datasets of primary CRC18 and liver tumour microenvironment19 were integrated using the Seurat integration method64. Edge spot selection was performed using the CellSelector function in Seurat, and the FindMarkers function was used for differential gene expression analysis of metastasis proximal versus distal and metastasis core versus centre. NicheNet65 was used to predict LR interactions at the metastatic leading edge (503 possible interactions). The ligand activity analysis from NicheNet was used to estimate the potential of these interactions to regulate differentially expressed genes (DEGs) between metastasis edge and core, yielding 109 LR pairs with regulatory potential. These were then intersected with SRFs (top and bottom decile of the screen, 62 factors).

Cross-validation with human and transcriptional mutational data

Interactors of liver-metastasis-specific mutations

The Genomic Features of Organotropism dataset20 was used to extract genes with mutations more frequently occurring in liver metastases as compared to primary tumours. This set of genes was then parsed with CellPhoneDB (v.3)66, CellTalkDB67 and NicheNet65 to filter for ligand and receptors and compile a list of their known interactors. The obtained interactors were then filtered for expression by hepatocytes according to the Human Protein Atlas (v.22.0; https://www.proteinatlas.org/)68. Specifically, we filtered out genes with transcript per million (TPM) ≤ 0.5 in the RNA GTEx tissue gene data, normalized TPM ≤ 0.5 in the RNA single-cell data (v.22.0 https://www.proteinatlas.org/humanproteome/single+cell+type) and ‘not detected’ in the normal tissue data (v.22.0; https://www.proteinatlas.org/; Ensembl v.103.38). The data used for the analyses described in this Article were obtained from the GTEx Portal on 30 May 2022 and/or dbGaP phs000424 on 30 May 2022. The interactors of LRs frequently mutated in liver metastases were then intersected with SRFs.

Interactors of liver-metastasis-specific DEGs

Two published datasets of primary CRC tumours and matched liver metastases21,22 were downloaded and imported into Seurat. Tumour cells were subsetted on the basis of EPCAM expression, then DEGs were calculated between liver metastases and primary CRC using the FindMarker function in Seurat. DEGs were parsed using CellPhoneDB (v.3)66, CellTalkDB67 and NicheNet65 to filter for ligand and receptors and compile a list of their known interactors, which were intersected with SRFs (top and bottom decile, 62 factors).

Organoid culture and modification

Mouse CRC organoid culture

Vil-creERT2;APCfl/fl;Trp53fl/fl;KrasG12D/WTSmad4KO (AKPS) and Vil-creERT2;APCfl/fl;Trp53fl/fl;KrasG12D/WTTgfbr2flox/floxAkt1myristoilated (APTAK) organoids were cultured in 50 μl Matrigel domes (Corning) as described previously69. To make complete medium, Advanced DMEM/F12 (Life Technologies) was supplemented with 10 mM HEPES (Life Technologies), 2 mM l-glutamine (Life Technologies), 100 mg ml−1 penicillin–streptomycin (1%), 1× B27 supplement (Life Technologies), 1× N2 supplement (Life Technologies) and 1 mM N-acetylcysteine (Sigma-Aldrich). Organoids were split every 3–5 days by mechanical dissociation. Splitting was always performed on the day before intrasplenic injection and 36 hours prior to orthotopic inoculation.

RNP-mediated Smad4 KO

Vil-creERT2;APCfl/fl;Trp53fl/fl;KrasG12D/WT mice were obtained from Owen Sansom (Beatson Institute for Cancer Research) and cultured under the above described conditions with supplementation of 100 ng ml−1 mouse recombinant noggin (LuBioScience, 250-38-250). Four domes of organoids were treated with 5 mM nicotinamide for 2–3 days before transfection. sgRNAs comprising both crRNA and tracrRNA sequences were obtained from IDT (Alt-R system). Targeting sequences were obtained from a previous study70. Organoids were collected, washed of Matrigel, and dissociated into single cells by incubation at 37 °C for 10 min in 1 ml prewarmed TrypLE Express Enzyme (Gibco). Cells were centrifuged at 190g for 3 min, resuspended in 1 ml complete medium with 5 mM nicotinamide and 10 µM Y-27632 dihydrochloride (Rock inhibitor) (StemCell, 72304), and seeded into two wells of a 48-well plate. Transfection was performed using the CRISPRmax kit (Thermo Fisher Scientific). In brief, 25 μl OPTImem supplemented with 1,250 ng Cas9 nuclease V3 (1081058), 240 ng sgRNA and 2.5 μl Cas9 Reagent Plus was mixed with 25 ml OPTImem with 1.5 μl CRISPRmax reagent, incubated for 10 min and added to each well. The cells were spinoculated for 1 h at 600g at 32 °C, then incubated for 4 h at 37 °C. Cells were then collected, resuspended in Matrigel and plated in complete medium supplemented with Rock inhibitor. Then, 3 days later, selection was started by adding medium supplemented with 10 ng ml−1 TGFβ (Peprotech, 100-21C-10UG) and lacking noggin. Selection was continued for 3 passages, then TGFβ was removed from the medium. Successful editing was confirmed by T7 endonuclease assay. Primers asymmetrically flanking the cut site were designed so as to yield fragments distinguishable by electrophoresis. Organoid DNA was extracted using the QuickExtract DNA Extraction Solution (Lucigen) and then PCR amplified. The PCR reaction mix consisted of 10 μl Q5 master mix, 6 μl H2O, 2 μl primer mix and 2 μl DNA. Then, 10 μl PCR products was mixed with 1.5 μl 10× NEB buffer 2 and 1.5 μl H2O and incubated in a thermocycler as follows: 10 min at 95 °C; from 95 °C to 85 °C with a ramp rate of −2 °C s−1; from 85 °C to 25 °C with a ramp rate of −0.3 °C s−1. Formed heteroduplexes were incubated with 2 μl T7 mix (10 μl NEBuffer 2, 10 μl T7 and 80 μl H2O) at 37 °C for 1 h. The reaction was stopped by the addition of 1 μl of 0.5 M EDTA. The samples were analysed by electrophoresis on a 2% agarose gel. Abrogation of SMAD4 signalling was further confirmed by the loss of Id3 expression, as assessed using quantitative PCR with reverse transcription (RT–qPCR).

Integration of the sLP-mCherry labelling system

The pcPPT-mPGK-attR-sLP-mCherry-WPRE vector was obtained from Ximbio and lentiviruses were generated according to a published protocol71. In brief, HEK293T cells were cultured on poly-d-lysine-coated plates and transfected with 4.4 μg PAX2, 1.5 μg VSV-G and 5.9 μg lentiviral vector with JetOptimus reagents. The supernatant was collected after 2 days, centrifuged 5 min at 500g and filtered through a 0.45 μm filter. Then, 4 domes of AKPS organoids were washed from Matrigel and dissociated into single cells by incubating them for 10 min in 1 ml prewarmed TripLE at 37 °C. Cells were centrifuged at 190g for 3 min, then resuspended in 2 ml infection medium containing 1.8 ml virus, 200 μl complete medium, 5 mM nicotinamide, 1.6 μl polybrene and 2 μl Rock inhibitor. The cells were plated into two wells of a 48-well plate and spinoculated for 1 h at 600g at 32 °C, then incubated 4 h at 37 °C. Cells were then collected, resuspended in Matrigel and plated into complete medium supplemented with Rock inhibitor. Then, 3 days later, the organoids were dissociated into single cells and mCherry+ cells were isolated by FACS using an the Aria III sorter (BD Biosciences). Organoids were further selected with 2 μg ml−1 puromycin for a week.

Integration of the luciferase reporter for BLI

To generate the pLVX-fireflyLuc-IRES-zsGreen1 vector, the protein coding sequence of firefly luciferase was amplified from an in-house plasmid, and cloned into EcoRI/BamHI-linearized pLVX-IRES-zsGreen1 (Takara) by InFusion (InF-fireflyLuc-F: TATTTCCGGTGAATTCCACCATGGAAGACGCCAAAAAC and -R: GAGAGGGGCGGGATCCTTACACGGCGATCTTTCCGCC). Sanger (Microsynth) and whole-plasmid (PlasmidSaurus) sequencing confirmed the identity of the construct and the absence of unwanted mutations. Lentiviral preparation and transduction of organoids was conducted as described above. Successfully transduced organoids were selected by FACS on the basis of GFP fluorescence and gating for live cells.

shRNA-mediated semaphorin KD

The sequences of shRNAs targeting Sema4a, Sema4c, Sema4d and Sema4g were obtained from The RNAi Consortium shRNA Library (Broad Institute) and cloned in an arrayed manner in a lentiviral vector expressing GFP as a selection marker based on a published plasmid backbone72. The EV control expressed a puromycin-resistance cassette for selection. Sanger (Microsynth) and whole-plasmid (PlasmidSaurus) sequencing confirmed the identity of each construct and the absence of unwanted mutations. Lentiviral preparation and transduction of organoids was conducted as described above. Organoids transduced with shRNAs targeting semaphorins were dissociated into single cells, incubated with Zombie Violet (1:500, BioLegend, 423113) and selected by FACS based on GFP fluorescence and gating for live cells. AKPS organoids transduced with the EV were also dissociated into single cells and subjected to sorting (only live-cell gate), and then selected by puromycin as described above. Semaphorin knockdown was assessed using RT–qPCR. For competitive seeding assays, AKPSSema4KD and AKPSEV organoids were grown separately and then mixed at a 1:1 ratio and mechanically dissociated for intrasplenic injection. A small fraction of the injection mix was seeded in three domes to estimate the injection ratios.

enAsCas12a-mediated KO of class IV semaphorins

AKPSSema4KO organoids were generated using enAsCas12a technology73,74. sgRNAs targeting Sema4a, Sema4c, Sema4d and Sema4g were obtained using the guide design tool CRISPick74,75 with the mouse GRCm38 reference genome and enAsCas12a CRISPRko mode. Two high-scoring sgRNAs (on-target efficacy score > 0.75) targeting different exons for each semaphorin were combined into an 8-mer pre-crRNA array (Sema4KO array). The Sema4KO array was cloned into a in a lentiviral vector expressed under the CMV promoter together with GFP and puromycin (pLVX-EF1a-EGFP-2A-Puro-Triplex-Sema4KO-array-WPRE)73. Lentiviral preparation and transduction of organoids was conducted as described above. AKPSSema4KO organoids were generated by co-transduction of pLVX-enAsCas12a-BSD (pRDA174, Addgene, 136476)74 and pLVX-EF1a-EGFP-2A-Puro-Triplex-Sema4KO-array-WPRE, and selected with 5 μg ml−1 blasticidin and 2 μg ml−1 puromycin for 7 days. Control organoids were transduced with pLVX-enAsCas12a and selected with 5 μg ml−1 blasticidin. GFP expression was confirmed by microscopy, then clonal lines were generated by single-cell picking, and screened for indels by next-generation-sequencing-based amplicon sequencing. For immunofluorescence staining of class IV semaphorins, organoids were seeded in Matrigel on eight-well chambers (Thermo Fisher Scientific). Then, 3 days after, the medium was removed from the wells and organoids were fixed with 400 μl 4% PFA for 20 min at room temperature. After washing twice with 400 μl 3% BSA in PBS, the organoids were permeabilized for 20 min at room temperature in 0.5% Triton X-100 in PBS. The organoids were incubated with mouse anti-SEMA4A (BioLegend, 148402), rat anti-SEMA4C-AF647 (Biotechne, FAB8497R), rat anti-SEMA4D-PE (BioLegend, 147603) and rabbit anti-SEMA4G (Thermo Fisher Scientific, BS-11479R) overnight in 1% BSA, 0.2% Trizol and 0.05% Tween-20. After washing three times with working solution, the organoids were incubated 1 h at room temperature with anti-mouse Alexa Fluor 405 and anti-rabbit Alexa Fluor 647 (Thermo Fisher Scientific, 1:400, in working solution). Nuclei were stained with DAPI (Sigma-Aldrich, 1:1,000).

Patient-derived CRC organoids

Human CRC organoids were obtained from the Visceral Surgery Research Laboratory at the University of Basel. Tissues from primary and liver metastases of patients with CRC were obtained from the University Hospital Basel after patient consent and ethical approval (Ethics Committee of Basel, EKBB, 2019-00816). To generate PDOs, tissue was cut into small pieces and, subsequently, enzymatically digested in 5 ml advanced DMEM/F-12 (Thermo Fisher Scientific, 12634028) containing 2.5 mg ml−1 collagenase IV (Worthington, LS004189), 0.1 mg ml−1 DNase IV (Sigma-Aldrich, D5025), 20 μg ml−1 hyaluronidase V (Sigma-Aldrich, H6254), 1% BSA (Sigma-Aldrich, A3059) and 10 μM LY27632 (Abmole Bioscience, M1817) for 1 h and 30 min at 37 °C under slow rotation and vigorous pipetting every 15 min. The tissue lysate was filtered through a 100 μM cell strainer and centrifuged at 300g for 10 min. The cell pellet was resuspended with growth-factor-reduced Matrigel (Corning, 356231), plated into 50 μl domes and overlaid with medium composed of advanced DMEM/F-12 supplemented with 10 mM HEPES (Thermo Fisher Scientific, 15630056), 100 μg ml−1 penicillin–streptomycin (Thermo Fisher Scientific, 10378-016), 1× GlutaMax (Thermo Fisher Scientific, 9149793), 100 μg ml−1 primocin (invivoGen, ant-pm-1), 1× B27 (Thermo Fisher Scientific, 17504044), 1.25 mM N-acetylcysteine (Sigma-Aldrich, A9165-25G), 10 mM nicotinamide (Sigma-Aldrich, N0636), 500 ng ml−1 R-spondin (EPFL SV PTPSP), 100 ng ml−1 noggin ((EPFL SV PTPSP), 50 ng ml−1 EGF (PeproTech, AF-100-15), 500 nM A83-01 (R&D Systems, 2939), 10 µM SB202190 (Sigma-Aldrich, S7076), 10 nM prostaglandin E2 (Tocris Bioscience, 2296), 10 nM gastrin (Sigma-Aldrich, G9145) and 10 µM Y-27632 dihydrochloride. The medium was changed every 3 days, and the organoids were passaged using 0.25% trypsin-EDTA (Life Technologies, 25200-056).

Cell lines

Mouse immortalized hepatocytes

AML12 cells were obtained from ATCC (CRL-2254) and cultured in DMEM:F12 Medium (Gibco) supplemented with 10% FBS, 10 µg ml−1 insulin, 5.5 µg ml−1 transferrin, 5 ng ml−1 selenium, 40 ng ml−1 dexamethasone and 1% penicillin–streptomycin.

Human immortalized hepatocytes

PTA-5565 cells (ATCC) stably labelled by H2B–mCherry were obtained from the Bentires-Alj laboratory (University of Basel) and cultured in William’s E Medium supplemented with 1% GlutaMax (Gibco), 5% FBS and 1% penicillin–streptomycin.

KPC cells

Ptf1a-Cre;KrasG12D/+;Trp53flox/+ (KPC) pancreatic ductal adenocarcinoma cells (B6J syngeneic) were donated by I. Guccini and cultured in 2D cultures in DMEM:F12 supplemented with 10% FBS and 1% penicillin–streptomycin. Cells were split every 3–5 days and on the day before surgery. Before intrasplenic injection, KPC cells were detached from culture flasks with 1 mM EDTA.

Melanoma cells

The Tyr-CreER;BrafCA;Ptenlox/lox (D4M-3A) B6 mouse melanoma line was generated previously76, obtained from Merck Millipore and cultured in Advanced DMEM:F12 supplemented with 10% FBS and 1% penicillin–streptomycin and 1× GlutaMax (Gibco).

All of the cell lines were tested for mycoplasma, no cell lines were authenticated.

In vitro assays

Arrayed screen with primary hepatocytes or AML12 cells

Plates (96 or 384 well) were coated with the Collagen-I Cell Culture Surface Coating Kit (ScienCell Research Laboratories) according to the manufacturer’s instructions. Primary mouse hepatocytes from Alb-cre;dCas9-SPH mice were isolated by perfusion as described above. After two washes in isolation buffer, the hepatocyte pellet was further purified by density separation according to a published protocol77. In brief, the pellet was resuspended in 10 ml isolation buffer and 10 ml Percoll solution (9 ml Percoll, 1 ml 10× PBS), then mixed thoroughly by inverting the tube several times. After centrifugation at 200g for 10 min at 4 °C, the hepatocytes were resuspended in isolation medium (supplemented with 1% penicillin–streptomycin) and plated at high density (15,000 hepatocytes per well in 96-well plates, 5,000 hepatocytes per well in 384-well plates). The same plating density was used for AML12dCas9-SPH cells, which were generated introducing doxycycline-inducible dCas9-SPH into the Rosa26 safe-harbour by recombinase-mediated cassette exchange78,79 and kept in culture with 2 μg ml−1 doxycycline. The next day, primary Alb-cre;dCas9-SPH hepatocytes or AML12-SPH were transfected with SB100X and transposon vectors harbouring sgRNAs against selected gene targets using Lipofectamine 3000 (Thermo Fisher Scientific). For every target, three sgRNAs were independently cloned and amplified into transposon vectors, and then pooled before transfection. Three wells were transfected for each target, and three wells were left untransfected. The next day, the transfection efficiency was estimated on the basis of GFP fluorescence. AKPSsLP-mCherry organoids were dissociated into single cells as described above, then 50 cells were seeded per well. After 5 days, colony formation was assessed by microscopy.

Stable OE of Plxnb2

AML12dCas9-SPH were treated for a week with 2 μg ml−1 doxycycline and then transfected with SB100X and a pool of three PT4-U6-sgRNA-CMV-GFP transposon vectors targeting Plxnb2, or sgNT, using Lipofectamine 3000 (Thermo Fisher Scientific). On the next day, cells were sorted for GFP+ fluorescence on the Aria III sorter (BD Biosciences) with a 70 μm nozzle and used for CFU assays as described above. Plxnb2 upregulation was assessed by RT–qPCR. To generate the pLVX-VSV-mmPLXNB2-IRES-Blast vector, the mouse Plxnb2 coding sequence was amplified from pmPB2-VSV (Roland Friedel, Addgene, 68038) and cloned into a BamHI/EcoRI-linearized and engineered pLVX-backbone (Takara), bearing BlasticidinR, by InFusion (Takara; InF-VSV-Plxnb2-F: TATTTCCGGTGAATTCACCATGTGGGTGACCAAACT and -R: GAGAGGGGCGGGATCTCAGAGGTCTGTAACCTTATTCTCA). Lentiviruses were generated as described above and used to transduce AML12 cells. The correct membrane localization was assessed by immunofluorescence with rabbit anti-VSV-G antibody (Thermo Fisher Scientific, PA1-29903). VSV-G+ cells were selected by FACS. Plexin B2 upregulation was assessed by flow cytometry using mouse anti-plexin-B2-PE (BioLegend, 145903).

Treatment with recombinant mouse and human plexin B2

Recombinant human plexin B2 (5329-PB-050, Biotechne) and mouse plexin B2 (6836-PB-050, Biotechne) were reconstituted at 100 μg ml−1 in PBS. Human or mouse organoids were dissociated into single cells as described above, mixed with recombinant plexin B2 in growth medium, then seeded into 384-well plates at a density of 50 cells per well, in the absence or presence of 5,000 human or mouse hepatocytes. Colony formation was scored by microscopy. Where indicated, cultures were supplemented with 50 μM RAC1 inhibitor NSC23766 or 1 ng μl−1 anti-plexin B2 monoclonal antibody (67265-1, Proteogenic). The EdU-incorporation assay was performed using the Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye (Invitrogen). In brief, 3 days after treatment of PDOs with rhPlexin B2, half of the culture medium was removed and replaced with 2× EdU-containing medium for 1 h, then the manufacturer’s instructions were followed.

Treatment with KLF4 inhibitor

AKPS organoids were seeded as single cells into 384-well plates in the presence of the KLF4 inhibitor WX2-43 (10 μM, Aobious). Then, 4 days later, colonies were fixed in 4% PFA, blocked and stained overnight with rabbit anti-Ki-67 (Abcam, ab15580). After washing, wells were incubated with anti-rabbit Alexa Fluor 594 (Thermo Fisher Scientific), F-actin was stained with Alexa Fluor 647 Phalloidin (1:400, Invitrogen, A22287) and nuclei with DAPI.

Generation of AAVs

Three sgRNA sequences for dCas9-SPH-mediated OE of Plxnb2 were obtained from the Caprano library55, four sgRNA sequences for Cas9-mediated knockout (KO) and two control non-targeting sgRNA were obtained from the Brie library80. A list of the sequences is provided in Supplementary Tables 1 and 3. Each guide was cloned into U6-sgRNA-EF1a-eGFP (Addgene, 117046) vector and amplified using the Maxi prep kit (Macherey-Nagel). To generate the AAV-mmALBpr-Cre-2A-moxGFP vector, the mouse Alb promoter was amplified from pALB-GFP (S. Thorgeirsson, Addgene, 55759) and cloned by InFusion (Takara; InF-mmAlb-F: CTGCGGCCGCACGCGTCTAGCTTCCTTAGCATGACGTTCCA and -R: GCATGGTGGCACCGGTGGGGTTGATAGGAAAGGTGATCTGT) into an AAV8 backbone, provided by A. Santinha (Platt laboratory, ETHZ-BSSE). GFP was replaced by PCR-out and InFusion with moxGFP (E. Snapp, Addgene, 68072; InF-noATG-moxGFP-F: AGGAGGTAGCGGATCCGTGTCCAAGGGCGAGGAG and R: TAGCGCTCGGTATCGATTTACTTGTACAGCTCGTCCATGCC). AAVs were generated and purified according to a slightly modified version of the AddGene protocols ‘AAV Production in HEK293T Cells’ and ‘AAV Purification by Iodixanol Gradient Ultracentrifugation’. In brief, 250 million HEK293T cells were seeded in a Five Chambers Cell-Stack (Corning). Then, 24 h later, the vectors were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, 112864) using polyethylenimine (PEI). After viral genome production and purification, total viral genomes were quantified using digital droplet PCR according to the Addgene protocol ‘ddPCR Titration of AAV Vectors’. AAVs were injected into the tail vein as described above.

Immunofluorescence

Formalin-fixed and embedded tissues

Livers were perfused with PBS, then the medial lobe was fixed with 4% PFA in PBS for 48 h, followed by 48 h PBS incubation and storage in 75% ethanol. Dehydration, formalin embedding and H&E staining were performed by the histology core facility of the University of Basel. Sections (5 μm) were deparaffinized with descending alcohol series and subjected to heat-induced epitope retrieval in 2.4 mM sodium citrate and 1.6 mM citric acid, pH 6, for 25 min in a steamer. Sections were washed with PBST (0.1% Tween-20 in PBS) and blocked for 1 h at room temperature in blocking buffer (5% BSA, 5% heat-inactivated normal goat serum in PBST). Sections were incubated overnight at 4 °C with the following primary antibodies (1:100, in blocking buffer): anti-CD146 (Abcam, ab75769), anti-α-SMA (Abcam, ab5694), anti-periostin (Abcam, ab227049) and anti-GFP (Aves Labs, GFP-1020). Sections were repeatedly washed in PBST and incubated with the following secondary antibodies (1:400, in blocking buffer) for 1 h at room temperature: AlexaFluor goat anti-rabbit 594 (A-11012), AlexaFluor goat anti-rabbit 647 (A-21244), Alexa Fluor goat anti-chicken 647 (A32933), all from Thermo Fisher Scientific. Nuclei were stained with DAPI (Sigma-Aldrich, 1:1,000) in blocking buffer for 15 min at room temperature. The sections were mounted with ProLong Gold (P36930, Invitrogen) and imaged on the Leica THUNDER Imager 3D Cell Imaging system, equipped with the Leica LED8 Light engine, Leica DFC9000 GTC sCMOS camera and the following filter sets: filter cube CYR71010 (excitation: 436/28, 506/21, 578/24, 730/40; dichroic: 459, 523, 598, 763; emission: 473/22, 539/24, 641/78, 810/80); filter cube DFT51010 (excitation: 391/32, 479/33, 554/24, 638/31; dichroic: 415, 500, 572, 660; emission: 435/30, 519/25, 594/32, 695/58) and extra emission filters (460/80, 535/70, 590/50, 642/80, 100%).

Fixed frozen tissue

After liver perfusion with PBS, the left lobe was incubated in 4% PFA at 4 °C for 1 h, then in 30% sucrose in PBS overnight at 4 °C and then embedded in Tissue-Tek OCT Compound (Sakura, 4583) for cryosectioning. Sections (8 μm) were washed three times, blocked and stained as described above with the following primary and secondary antibodies: anti-glutamine synthetase (1:100, BioLegend 856201), anti-plexin-B2-PE (1:500, BioLegend, 145903), anti-GFP-AlexaFluor-488 (1:200, Thermo Fisher Scientific, A-21311), anti-ZEB1 (1:400, Novus, NBP1-05987), anti-α-SMA (1:1,000, Sigma-Aldrich, A2547), anti-CD146 (Abcam, ab75769), anti-E-cadherin (Biotechne, AF748), anti-EPCAM (Abcam 2884975), anti-GRHL2 (Abcam, ab271023), anti-KLF4 (Biotechne, AF3158), anti-ELF3 (Thermo Fisher Scientific, PA5-120996) and anti-Sema4A (BioLegend, 148402). DAPI counterstain, mounting and imaging was performed as described above. F-actin was stained by incubating blocked slides for 2 h at room temperature with Alexa Fluor 647 Phalloidin (1:400, Invitrogen, A22287).

Multiplexed immunofluorescence and quantification

Multiplexed immunofluorescence was performed on the Comet instrument (Lunaphore) with the following antibodies: anti-cleaved caspase 3 (Cell Signaling, 9661), anti-CD68 (Abcam, ab125212), anti-CD4 (Abcam, ab183685), anti-Ki-67 (Abcam, ab15580), anti-E-cadherin (Cell Signaling, 3195), anti-α-SMA (1:1,000, Sigma-Aldrich, A2547), anti-CD146 (Abcam, ab75769). The fields of view (FOVs) containing individual liver metastases were cropped and saved using the HORIZON software (Lunaphore). Each condition (sgNT or sgPlxnb2 OE) had a minimum of five FOVs representing five different lesions taken from two mice. The individual FOVs were analysed in FIJI. In brief, each channel was thresholded manually, followed by application of a median filter for signal smoothing and filling of holes. Each image was overlaid with its corresponding thresholded image to verify the accuracy of the thresholding. The region corresponding to tumour within a FOV was demarcated as a ROI and the area covered by a specific antibody signal was quantified as the number of pixels within the thresholded image with respect to the total number of pixels within the ROI. For quantification of dividing tumour cells, signals from both Ki-67 and ECAD were used: the overlap between the two signals was calculated, then the area of dividing tumour cells was determined as Ki-67+ pixels within the overlap area over the area occupied by the nuclei of all cells (calculated using DAPI as a marker).

Organoids

After fixation in 4% PFA at 4 °C for 2 h, and blocking in 5% BSA-PBS solution with 0.2% Triton X-100, the samples were stained with primary (overnight) and secondary antibodies (4 h) (anti-ZEB1 (1:400, Novus, NBP1-05987), anti-E-cadherin (1:200, BD Biosciences, 610181)) and DAPI counterstain, and mounted in 3% low-melting-point agarose in glass-bottom plates and then imaged.

Quantification of metastatic foci and lesion area

H&E sections were imaged on the Leica DMi8 inverted microscope, equipped with a FLEXACAM C1 12 MP CMOS camera and analysed using QuPath software81. Whole-tissue area and single-liver metastases were manually isolated, producing a measure for whole-section area, metastatic area (μm2) and metastasis number per section. Two non-consecutive sections quantified per animal, and a mean was calculated for the number of metastatic foci per liver section.

In situ hybridization

Single-molecule in situ hybridization

Custom DNA smFISH probes for Plxnb2 were designed in house and synthesized by Biosearch Technologies containing a 3′ amine reactive group (a list of probes is provided in Supplementary Table 3). All of the probes were pooled and labelled with AlexaFluor 594 dye according to a previously published protocol82. Mouse tissues were collected and fixed with 4% PFA in PBS for 3 h followed by overnight incubations in 30% sucrose, 4% PFA in PBS at 4 °C. Fixed tissues were embedded in Tissue-Tek OCT Compound (Sakura, 4583). Tissue sections (8 µm) were sectioned onto poly-l-lysine-coated coverslips, allowed to adhere by drying at room temperature for 10 min, followed by 15 min fixation in 4% PFA and overnight permeabilization in 70% ethanol. Probe hybridization was performed according to a previously published protocol82. Images were acquired using a ×63 oil-immersion objective with NA = 1.4 on the Leica THUNDER Imager 3D Cell Imaging system, equipped with a Leica LED8 Light engine and Leica DFC9000 GTC sCMOS camera. For quantification, 3–4× FOVs covering the entire width of the tissue were acquired for each sample and the images were processed using the Thunder deconvolution algorithm. Maximum-intensity projections of the processed images were rendered using ImageJ. Dot counting to determine the transcript numbers for each FOV was performed with FISHQuant83 using the automatic thresholding function and the cell number was determined by segmenting and counting the nuclei using CellPose84. Spot counting and nucleus numbers were manually verified to ensure correctness. The average number of spots per cell was then measured by dividing the number of spots within the FOV by the number of nuclei.

Multiplexed in situ hybridization (Molecular Cartography)

Probe design, sample preparation imaging and processing were conducted as previously described85. The analysis of the data, including cell segmentation, cell type annotation and portal versus central area annotation was described previously86. Visualizations were generated in ImageJ using genexyz Polylux tool plugin from Resolve BioSciences.

RT–qPCR

RNA extraction from fresh organoids, cells or liver tissue was performed using the Qiagen RNeasy purification kit. Then, 1 ng of total RNA was reverse transcribed using the cDNA synthesis kit (Takara Bio) according to the manufacturer’s instructions. Expression of genes of interest was quantified with primers listed in Supplementary Table 3, by RT–qPCR using the Applied Biosystems SYBR Green Kit monitored by the QuantStudio3 system (Applied Biosystems). The samples were analysed in technical triplicates and the average cycle threshold values were normalized to Gapdh using the ∆∆CT method87.

Bulk RNA-seq experiments and analysis

Library preparation

RNA was extracted as described above from the livers of Alb-cre;SPH mice 7 days after injection with AAV8-sgPlxnb2-OE-EF1a-eGFP or AAV8-sgNT-EF1a-eGFP, livers of B6 mice bearing AKPS colon tumours, and organoids. Libraries for bulk RNA-seq were prepared using the mcSCRB-seq protocol88 (organoids) or the Takara SMART-Seq Stranded Kit (634762, mouse livers). Libraries were quality-controlled using the dsDNA high-sensitivity kit (Life Technologies, Q32854) on the Qubit 4 fluorometer (Thermo Fisher Scientific) and using the high-sensitivity D1000 reagents and tapes (Agilent, 5067-5585, 5067-5584) on the TapeStation 4200 (Agilent Technologies) and sequenced on the NovaSeq 6000 (Illumina) system using the NovaSeq SP Reagent Kits (100 cycles).

Analysis

Reads were demultiplexed with Bcl2fastq v.2.20.0.422 (Illumina) and quality-checked with FastQC89. Adaptors were trimmed with cutadapt57. Data were processed using the zUMIs (v.2.9.4) platform to convert reads to count matrices per sample. Differential gene expression analysis was performed using edgeR90. GSEA was performed using the Bioconductor package fgsea with the default parameters on genes ranked by log[fold change]91. The Gene Ontology Biological Process and Hallmarks gene set collections from the Molecular Signatures Database were imported into R using the package msigdbr92. Cell type composition was estimated for significantly up- and downregulated genes in Enrichr93 using Tabula Muris94 as a reference (odds ratio test).

scRNA-seq

Library preparation

AKPS organoids were dissociated into single cells and incubated with 2 μg ml−1 rmPlexin B2 or vehicle in culture medium for 2 h at 37 °C. Cells were filtered, counted and loaded onto the GemCode Single-cell Instrument (10x Genomics). Libraries were generated according to the manufacturer’s instructions from the Chromium Next GEM Single Cell 3′ end Reagent Kits v1.1 protocol. The quality and quantity of all of the libraries were assessed using the dsDNA high-sensitivity (HS) kit (Life Technologies, Q32854) on the Qubit 4 fluorometer (Thermo Fisher Scientific) and using the high-sensitivity D1000 reagents and tapes (Agilent, 5067-5585, 5067-5584) or high sensitivity D5000 reagents and tapes (Agilent, 5067-5593, 5067-5592) on the TapeStation 4200 system (Agilent Technologies). Paired-cell sequencing was performed for all libraries using the NovaSeq SP Reagent Kits (100 cycles).

Analysis

BCL files were demultiplexed using Bcl2fastq v.2.20.0.422 from Illumina, then single-cell count matrices were generated using Cell Ranger (v.5.0.0, 10x Genomics) with GRCm38 v.2020-A gene code. Datasets were integrated and processed using Seurat. Downstream analysis was conducted in R (v.4.1.0) using the Seurat (v.4.0.3197) package. The Seurat objects (rmPlexin B2-treated and control) were merged and cells with <100 or >2,500 detected genes were excluded. After log-normalization, the data were scaled regressing for mitochondrial reads, and principal component analysis was performed based on the 2,000 most variable features. Clustering and UMAP visualization were performed using ten principal components and a resolution of 0.2 for the shared nearest-neighbour clustering algorithm. Cluster markers were computed using the FindAllMarkers function, and GSEA was performed as described above. KLF4-target genes were obtained from the CHEA Transcription Factor Binding Site Profiles database95 and computed using the AddModuleScore function. EMT and MET signatures were obtained from the GO Biological Process dataset. A list of all signatures and gene sets is provided in Supplementary Table 3.

snRNA-seq and snATAC–seq

Nucleus extraction and library construction

Combined profiling of gene expression and chromatin accessibility was performed from fresh frozen OCT-embedded livers. For each sample (2 sgNT and 2 sgPlxnb2 OE livers), three 50 μm liver sections were transferred into a prechilled gentleMACS C-tube (Miltenyi) and homogenized in the gentleMACS Octo Dissociator with 2 ml nucleus extraction buffer (Miltenyi). The nucleus suspension was filtered through a 70 µm SmartStrainer into a DNA-low-binding 5 ml tube (Eppendorf) and centrifuged at 150g for 3 min, at 4 °C. The pellet was resuspended in 5 ml 1% BSA in PBS and strained through a 30 µm SmartStrainer into a new tube. After centrifugation, the pellet was washed again in 5 ml 1% BSA in PBS. Nuclei were resuspended in 500 µl 1% BSA in PBS, counted and visually inspected. 16,000 nuclei per sample were profiled using the Chromium Single Cell Multiome ATAC + Gene Expression kit (10x) according to manufacturer’s instructions. Libraries were quality controlled and sequenced as described above.

Analysis

BCL files were demultiplexed using Bcl2fastq v.2.20.0.422 from Illumina, then single-nucleus count matrices were generated using Cell Ranger Arc (10x Genomics) with GRCm38 v2020-A gene code. RNA and chromatin profiles of the four datasets were integrated with Signac96 (v.1.12.0) using the FindIntegrationAnchors function. Ambient RNA was removed with the decontX package97 (v.1.0.0), then cell types were annotated based on the RNA profile. Tumour cells were subsetted and DEGs were calculated using the FindMarker function, and GSEA was performed as described above. Chromatin peaks were called with the CallPeaks function, then differentially open peaks and motifs were identified using the AddPeaks, FindPeaks and FindMotifs functions.

Analysis of class IV semaphorins in human CRC

Protein atlas stainings

SEMA4A, SEMA4D, SEMA4C and SEMA4G antibody stainings were obtained from the Human Protein Atlas42 with the R package HPAanalyze98.

CNV analysis of class IV semaphorin genes

The CNV status of SEMA4A, SEMA4D, SEMA4C and SEMA4G in 290 patients with CRC was obtained from the TGCA-COAD dataset45.

Published scRNA-seq datasets

Preprocessed and annotated scRNA-seq profiles of epithelial cells in the KUL and Samsung dataset were obtained from the Synapse repository syn3494242843. scRNA-seq datasets of matched liver metastases and primary tumours were obtained from the Gene Expression Omnibus under the accession numbers GSE225857 (ref. 21) and GSE178318 (ref. 22), and imported into Seurat. Epithelial cells were subsetted on the basis of EPCAM expression. Averaged expression of SEMA4A, SEMA4D, SEMA4C and SEMA4G was computed using the AddModuleScore function.

Kaplan–Meier analysis

Kaplan–Meier analysis of 1,211 patients with CRC was performed using an online tool (http://kmplot.com). Recurrence-free survival was stratified by SEMA4A, SEMA4C, SEMA4D and SEMA4G expression in the Affymetrix colon dataset, using best cut-off.

Statistics and reproducibility

Statistical analysis and visualization were performed using R (v.4.1.0, R Foundation for Statistical Computing), R Studio and the package ggplot262 or Prism v.8.2.0. Statistical significance tests were performed as described in each figure legend, and P values were adjusted for multiple testing. Micrographs are representative of multiple biological replicates (n ≥ 2).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *