Lithocholic acid binds TULP3 to activate sirtuins and AMPK to slow down ageing

Data reporting

The chosen sample sizes were similar to those used in this field: n = 4–5 samples were used to evaluate the levels of metabolites in serum^76,77, cells^10,78, tissues^10,16,78,79, nematodes^80,81,82 and flies^83,84,85; n = 4–5 samples to determine OCRs in tissues^78,86 and nematodes^87,88,89; n = 3–4 samples to determine the mRNA levels of a specific gene¹¹; n = 2–6 samples to determine the expression levels and phosphorylation levels of a specific protein¹¹; n = 20–33 cells to determine AXIN translocation and lysosomal pH^10,12; n = 4 replicates to determine SIRT1 activity^30,90; n = 200 worms to determine lifespan^91,92,93; n = 60 worms to determine healthspan^94,95,96; n = 200 flies, male or female, to determine lifespan^97,98,99; n = 60 flies, male or female, to determine healthspan^100,101,102; n = 4–8 mice for energy expenditure (EE) and respiratory quotient (RQ) calculations⁷⁸; n = 5 mice for body composition anaylses⁷⁸; n = 6 mice for muscle fibre type analyses^74,103,104; n = 10–11 mice for running duration analyses^12,78; and n = 35–38 mice for grasp strength analyses⁷⁸. No statistical methods were used to predetermine the sample sizes. All experimental findings were repeated as stated in the figure legends, and all additional replication attempts were successful. For animal experiments, mice, nematodes and flies were housed under the same condition or place. For cell experiments, cells of each genotype were cultured in the same CO₂ incubator and were seeded in parallel. Each experiment was designed and performed along with proper controls, and samples for comparison were collected and analysed under the same conditions. Randomization was applied wherever possible. For example, during MS analyses (for metabolites and proteins), samples were processed and analysed in random order. For animal experiments, sex-matched (for mice and flies) and age-matched littermate animals in each genotype were randomly assigned to LCA or vehicle treatments. In cell experiments, cells of each genotype were parallel seeded and randomly assigned to different treatments. Otherwise, randomization was not performed. For example, when performing IB, samples needed to be loaded in a specific order to generate the final figures. Blinding was applied wherever possible. For example, samples, cages or agar plates or vials during sample collection and processing were labelled as code names that were later revealed by the individual who picked and treated the animals or cells but did not participate in sample collection or processing until assessing the outcome. Similarly, during microscopy data collection and statistical analyses, the fields of view were chosen on a random basis and were often performed by different operators, thereby preventing potentially biased selection for desired phenotypes. Otherwise, blinding was not performed, such as the measurement of OCR and SIRT1 activity in vitro, as different reagents were added for particular reactions.

Mouse strains

WT C57BL/6J mice (000664) were obtained from the Jackson Laboratory. AXIN^F/F (AXIN1^F/F) and LAMTOR1^F/F mice were generated and validated as previously described¹¹. AMPKA1^F/F (014141) and AMPKA2^F/F mice (014142) were obtained from the Jackson Laboratory, provided by S. Morrison, and PKCZ^F/F mice (024417) were provided by R. Huganir. AXIN2^F/F mice (T008456) were purchased from Shanghai Model Organisms Center. The muscle-specific LAMTOR1-knockout (LAMTOR1-MKO) mice and the liver-specific LAMTOR1-knockout (LAMTOR1-LKO) mice were generated by crossing LAMTOR1^F/F mice with Mck–cre and Alb–cre mice as previously described and validated¹¹, AXIN-LKO mice were generated by crossing AXIN^F/F mice with Alb–cre mice (validated in ref. ¹³), and AXIN1/2-MKO mice were generated by crossing AXIN1/2^F/F mice with HSA–creERT2 mice (025750; Jackson Laboratory). AXIN1 and AXIN2 from AXIN1/2^F/F, HSA–creERT2 mice were removed from muscle by intraperitoneally injecting mice with tamoxifen (dissolved in corn oil) at 200 mg kg^–1, 4 times a week for 1 week. TULP3^F/F mice (S-CKO-17725) were purchased from Cyagen.

WT V1E1 or V1E1(3KR) was introduced to the muscle of AMPKA1/2^F/F mice through the Rosa26-LSL(loxP-Stop-loxP) system¹⁰⁵, followed by crossing with HSA-creERT2 mice. The removal of the muscular AMPK gene and the LSL cassette ahead of introduced V1E1 and V1E1(3KR) (to trigger the expression of introduced V1E1) was achieved by intraperitoneally injecting mice with tamoxifen. To introduce V1E1 or V1E1(3KR) into AMPKA1/2^F/F mice, cDNA fragments encoding V1E1 or V1E1(3KR) were inserted into a Rosa26-CTV vector¹⁰⁶, followed by purification of the plasmids using the CsCl density gradient ultracentrifugation method. Next, 100 μg plasmid was diluted with 500 μl di-distilled water, followed by concentrating by centrifugation at 14,000g at room temperature in a 30-kDa cut-off filter (UFC503096, Millipore) to 50 μl solution. The solution was diluted with 450 μl di-distilled water, followed by another two rounds of dilution–concentration cycles. The plasmid was then mixed with 50 μl di-distilled water to a final volume of 100 μl, followed by mixing with 10 μl sodium acetate solution (3 M stock concentration, pH 5.2). This sample was then mixed with 275 μl ethanol, followed by incubating at room temperature for 30 min to precipitate the plasmid. The precipitated plasmid was collected by centrifugation at 16,000g for 10 min at room temperature, followed by washing with 800 μl of 75% (v/v) ethanol (in di-distilled water) twice. After evaporating the ethanol by placing the plasmid next to an alcohol burner lamp for 10 min, the plasmid was dissolved in 100 μl nuclease-free water. The plasmid, along with SpCas9 mRNA and the sgRNAs against the mouse Rosa26 locus, was microinjected into in vitro fertilization (IVF) embryos of AMPKA1/2^F/F mice. To generate the SpCas9 mRNA, 1 ng pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene 41815 (ref. ¹⁰⁷), into the pcDNA3.3 vector; diluted to 1 ng μl^–1) was amplified using a Phusion High-Fidelity DNA Polymerase kit on a thermocycler (T100, Bio-Rad) with the following programs: pre-denaturing at 98 °C for 30 s; denaturing at 98 °C for 10 s, annealing at 68 °C for 25 s, then extending at 72 °C for 2 min in each cycle; and final extending at 72 °C for 2 min; cycle number: 33. The following primer pairs were used: 5′-CACCGACTGAGCTCCTTAAG-3′ and 5′-TAGTCAAGCTTCCATGGCTCGA-3′. The PCR product was then purified using a MinElute PCR Purification kit following the manufacturer’s instructions. The purified SpCas9 PCR product was subjected to in vitro transcription using a mMESSAGE mMACHINE T7 Transcription kit following the manufacturer’s instruction (with minor modifications). In brief, 5.5 μl (300 ng μl^–1) of SpCas9 PCR product as the template was mixed with 10 μl of 2× NTP/ARCA solution, 2 μl of 10× T7 reaction buffer, 0.5 μl RNase inhibitor, 2 μl T7 enzyme mix and 4.5 μl nuclease-free water, followed by incubating at 37 °C for 2 h. This sample was then mixed with 1 μl Turbo DNase, followed by incubating at 37 °C for 20 min to digest the template. The sample was then mixed with 20 μl of 5× E-PAP buffer, 10 μl of 25 mM MnCl₂, 10 μl of 10 mM ATP, 4 μl E-PAP enzyme and 36 μl nuclease-free water, followed by incubating at 37 °C for 20 min for poly(A) tailing. The tailed product was then purified using a MEGAclear Transcription Clean-Up kit following the manufacturer’s instructions (with minor modifications). In brief, 20 μl tailed RNA was mixed with 20 μl elution solution, followed by mixing with 350 μl binding solution concentrate. Next, 250 μl ethanol was added to the mixture, followed by passing it through a filter cartridge and washing with 250 μl wash solution twice. The RNA was then eluted with 50 μl pre-warmed (at 90 °C) elution solution. The sgRNAs were prepared as for SpCas9 mRNA preparation, except that the gRNA cloning vector (Addgene, 41824, ref. ¹⁰⁷) was used as the template, and the following program was used: pre-denaturing at 98 °C for 30 s; denaturing at 98 °C for 10 s, annealing at 60 °C for 25 s, then extending at 72 °C for 20 s in each cycle; and final extending at 72 °C for 2 min; cycle number: 33. The following primers were used: 5′-GAAATTAATACGACTCACTATAGGCGCCCATCTTCTAGAAAGACGTTTTAGAGCTAGAAATAGC-3′, and 5′-AAAAGCACCGACTCGGTGCC-3′. In addition, in vitro transcription was performed using a MEGAshortscript T7 Transcription kit, in which a mixture containing 7.5 μl (100 ng μl^–1) purified PCR product, 2 μl T7 10× T7 reaction buffer, 2 μl T7 ATP solution, 2 μl T7 CTP solution, 2 μl T7 GTP solution, 2 μl T7 UTP solution, 0.5 μl RNase inhibitor, 2 μl T7 enzyme mix and 7.5 μl nuclease-free water was prepared. Also, the poly(A) tailing assay was not performed.

The prepared Rosa26-CTV-V1E1, SpCas9 mRNA and Rosa26 sgRNA plasmids were then microinjected into each zygote from AMPKA1/2^F/F mice. To prepare the zygotes, AMPKA1/2^F/F mice (according to ref. ¹⁰⁸, with modifications) were first subjected to IVF. In brief, 4-week-old AMPKA1/2^F/F female mice were intraperitoneally injected with pregnant mare’s serum gonadotrophin (PMSG) at a dose of 10 U per mouse. At 46 h after PMSG injection, 10 U per mouse of human chorionic gonadotrophin (hCG) was intraperitoneally injected. At 12 h after hCG injection, oocytes from the oviducts of female mice, along with sperms from cauda epididymides and vasa deferentia of 16-week-old, proven stud AMPKA1/2^F/F male mice, were isolated. To isolate oocytes, oviducts were briefly left on a filter paper, followed by incubating in a human tubal fluid medium (HTF)–GSH drop on an IVF dish (prepared by placing 200 μl HTF solution supplemented with 125 mM GSH on a 35-mm dish to form a drop, followed by covering the drop with mineral oil and pre-balancing in a humidified incubator containing 5% CO₂ at 37 °C for 0.5 h before use). The ampulla was then torn down by forceps, and the cumulus oocyte masses inside were collected and transferred to another HTF–GSH drop. To isolate sperm, cauda epididymides and vasa deferentia were briefly left on a filter paper, followed by penetrating with a 26 G needle on the cauda epididymides 5 times. Sperm were then released onto a HTF drop on a sperm capacitation dish (prepared by placing 200 μl HTF solution on a 35-mm dish to form a drop, followed by covering the drop with mineral oil and pre-balancing in a humidified incubator containing 5% CO₂ at 37 °C for 12 h before use) by slightly pressing or squeezing the cauda epididymides, followed by incubation in a humidified incubator containing 5% CO₂ at 37 °C for 0.5 h. The capacitated, motile sperm (located on the edge of each HTF drop) were then collected, followed by adding them to the oocyte masses soaked in the HTF–GSH drop, 8 μl per drop. The IVF dishes containing oocyte masses and sperm were then cultured in a humidified incubator containing 5% CO₂ at 37 °C for 4 h, followed by collecting and washing oocytes in a KSOM drop (freshly prepared by placing 20 μl KSOM medium on a 35-mm dish to form a drop, followed by covering the drop with mineral oil and pre-balancing in a humidified incubator containing 5% CO₂ at 37 °C for 0.5 h) twice. The oocytes were then cultured in a HTF–GSH drop on an IVF dish for another 12 h in a humidified incubator containing 5% CO₂ at 37 °C. The presumptive zygotes (in which two pronuclei and an extruded, second polar body could be observed) were then picked up. Next, 10 pl DNA mixture containing Rosa26-CTV-V1E1 plasmid (20 ng μl^–1 final concentration), SpCas9 mRNA (120 ng μl^–1 final concentration) and Rosa26 sgRNA (100 ng μl^–1) was microinjected into each of the zygotes and were cultured in KSOM medium at 37 °C in a humidified incubator containing 5% CO₂ for 16 h. Zygotes (20 per mouse) at the 2-cell stage were picked and transplanted into pseudopregnant ICR female mice (8–10 weeks old, >26 g; prepared by breeding the in-oestrus female with a 14-week-old, vasectomized male at 1 day before the transplantation), and offspring carrying the LSL-V1E1 or LSL-V1E1(3KR) allele were further outcrossed 6 times to C57BL/6 mice before crossing with HSA-creERT2 mice. Mice were validated by genotyping. For genotyping the Rosa26 locus, the following programs were used: pre-denaturing at 98 °C for 300 s; denaturing at 95 °C for 30 s, annealing at 64 °C for 30 s, then extending at 72 °C for 45 s in each cycle for 5 cycles; denaturing at 95 °C for 30 s, annealing at 61 °C for 30 s, then extending at 72 °C for 45 s in each cycle for 5 cycles; denaturing at 95 °C for 30 s, annealing at 58 °C for 30 s, then extending at 72 °C for 45 s in each cycle for 5 cycles; denaturing at 95 °C for 30 s, annealing at 55 °C for 30 s, then extending at 72 °C for 45 s in each cycle for 5 cycles; and final extending at 72 °C for 10 min. For genotyping other genes and elements, the following programs were used: pre-denaturing at 95 °C for 300 s; denaturing at 95 °C for 30 s, annealing at 58 °C for 40 s, then extending at 72 °C for 30 s in each cycle; and final extending at 72 °C for 10 min; cycle number: 35. The following primers were used: 5′-CAGGTAGGGCAGGAGTTGG-3′ and 5′-TTTGCCCCCTCCATATAACA-3′ for HSA–cre; 5′-AGTGGCCTCTTCCAGAAATG-3′ and 5′-TGCGACTGTGTCTGATTTCC-3′ for the control of HSA–cre; 5′-CCCACCATCACTCCATCTCT-3′ and 5′-AGCCTGCTTGGCACACTTAT-3′ for Prkaa1, 5′-GCAGGCGAATTTCTGAGTTC-3′ and 5′-TCCCCTTGAACAAGCATACC-3′ for Prkaa2, 5′-TCTCCCAAAGTCGCTCTGAG-3′, 5′-AAGACCGCGAAGAGTTTGTC-3′, and 5′-ATGCTCTGTCTAGGGGTTGG-3′ for Rosa26, 5′-CCACACAGGCATAGAGTGTCT-3′ and 5′-TTTGCACAAGCCGACCTTTC-3′ for the 5′ terminus of Rosa26–V1E1 (the presence of Rosa26–V1E1 recombination), and 5′-CTCCACACAGGCATAGAGTGT-3′ and 5′-TTGCACAAGCCGACCTTTCT-3′ for the 3′ terminus of Rosa26–V1E1, 5′-AGAGAATTCGGATCCATGGCTCTCAGCGATGCTGA-3′ and 5′-CTTCCATGGCTCGAGGTCCAAAAACTTCCTGTTGGC-3′ for generating PCR products for sequencing V1E1.

To generate mice with muscular knockout of Tulp3 and with re-introduction of TULP3 or TULP3(4G), MYC-tagged TULP3 or TULP3(4G) was introduced to TULP3^F/F mice under the Rosa26-LSL system as described above, followed by crossing with HSA-creERT2 mice and intraperitoneal injection of tamoxifen into the mice. Mice were validated by genotyping using the programs and primers described above, except that primers 5′-TTAAACTAACCAGGGTCTCACTGT-3′ and 5′-GTTCCAGTACAATGGAAAGGAAAGG-3′ were used for Tulp3, 5′- CCACACAGGCATAGAGTGTCT-3′ and 5′- AGCTTAGCCTGTCGCATCTT-3′ were used for Rosa26–TULP3, and 5′- AGAGAATTCGGATCCATGGAGGCTTCGCGCTGC-3′ and 5′- CTTCCATGGCTCGAGTTCACACGCCAGCTTACTGT-3′ were used for generating PCR products for sequencing Tulp3.

CR and fasting treatments of mice

Protocols for all mouse experiments were approved by the Institutional Animal Care and the Animal Committee of Xiamen University (XMULAC20180028 and XMULAC20220050). Unless stated otherwise, mice were housed with free access to water and standard diet (65% carbohydrate, 11% fat, 24% protein) under specific pathogen-free conditions. The light was on from 8:00 to 20:00, with the temperature kept at 21–24 °C and humidity at 40–70%. Only male mice were used in the study, and male littermate controls were used throughout.

Mice were individually caged for 1 week before each treatment. For fasting, the diet was withdrawn from the cage at 17:00, and mice were killed at indicated time points by cervical dislocation. For CR, each mouse was fed 2.5 g standard diet (approximately 70% of ad libitum food intake for a mouse at 4 months old and older) at 17:00 each day.

The following ages of mice were used for analyses: (1) for IB and the measurement of adenylates, WT mice aged 5 weeks (treated with LCA for 1 week starting from 4 weeks old), and AXIN-LKO, AXIN-MKO, LAMTOR1-LKO and LAMTOR1-MKO mice aged 7 weeks (treated with LCA for 1 week starting from 6 weeks old); (2) for immunohistochemistry (IHC), V1E1(3KR)-expressing mice and WT V1E1-expressing mice aged 18 months (into which tamoxifen was injected at 16 months old, and treated with LCA for 1 month starting from 17 months old), and TULP3(4G)-expressing mice and WT TULP3-expressing mice aged 20.5 months (into which tamoxifen was injected at 16 months old and subjected to CR for 3.5 months starting from 17 months old); (3) for determination of the rejuvenating effect of LCA in mice, V1E1(3KR)-expressing mice and WT V1E1-expressing mice aged 18 months (into which tamoxifen was injected at 16 months old and treated with LCA for 1 month starting from 17 months old), and TULP3(4G)-expressing mice and WT TULP3-expressing mice aged 20.5 months (into which tamoxifen was injected at 16 months old and subjected to CR for 3.5 months starting from 17 months old); and (4) for all the other experiments, mice aged 4 weeks.

Formulation of LCA

LCA was formulated as previously described¹. In brief, for cell-based experiments, LCA powder was dissolved in DMSO to a stock concentration of 500 mM and was aliquoted and stored at −20 °C. The solution was placed at room temperature for 10 min (until no precipitate was visible) before adding to the culture medium. Note that any freeze–thaw cycle was not allowed to avoid the re-crystallization of LCA (which otherwise formed sheet-like, insoluble crystals) in the stock solution.

For mouse experiments, LCA was coated with (2-hydroxypropyl)-β-cyclodextrin before given to animals. To coat LCA, LCA powder was dissolved in 100 ml methanol to a concentration of 0.01 g ml^–1, followed by mixing with 308 ml (2-hydroxypropyl)-β-cyclodextrin solution (by dissolving (2-hydroxypropyl)-β-cyclodextrin in 30% (v/v, in water) methanol to 0.04 g ml^–1, followed by a 30 min of sonication). The control vehicle was similarly prepared but with no LCA added to the (2-hydroxypropyl)-β-cyclodextrin solution. After evaporating at 50 °C and 90 r.p.m. in a rotary evaporator (Rotavator R-300, Vacuum Pump V-300, BUCHI), the coated powder was stored at 4 °C for no more than 2 weeks and was freshly dissolved in drinking water to 1 g l^–1 before given to mice.

For nematode experiments, LCA at desired concentrations was freshly dissolved in DMSO and was added to warm (cooled to approximately 60 °C after autoclaving) nematode growth medium¹⁰⁹ (NGM; containing 0.3% (w/v) NaCl, 0.25% (w/v) bacteriological peptone, 1 mM CaCl₂, 1 mM MgSO₄, 25 mM KH₂PO₄-K₂HPO₄, pH 6.0, 0.02% (w/v) streptomycin and 5 μg ml^–1 cholesterol). The medium was used to make NGM plates by adding 1.7% (w/v) agar. The plates were stored at 20 °C for no more than 3 days.

For fly experiments, LCA was coated and dissolved in water as for the mouse experiments and was added to Bloomington Drosophila Stock Center (BDSC) standard cornmeal medium¹¹⁰ (for regular culture). The BDSC standard cornmeal medium was prepared as previously described but with minor modifications¹¹⁰. In brief, 60.5 g dry yeast, 35 g soy flour, 255.5 g cornmeal, 20 g agar and 270 ml corn syrup were mixed with 3,500 ml water in a stockpot. The mixture was thoroughly stirred using a long-handled soup spoon and then boiled, during which lumps formed were pressed out using the back of the spoon. After cooling to approximately 60 °C, 16.8 ml propionic acid was added to the medium followed by stirring with the spoon. The medium was then dispensed into culture vials (6 ml each). The vials of medium were covered with a single-layer gauze, followed by gentle blowing with air using a fan at room temperature overnight. Next, 100 μl LCA solution (dissolved in (2-hydroxypropyl)-β-cyclodextrin as for mice) at the desired concentration was then layered (added dropwise) onto the surface of the medium of each vial, followed by blowing with breeze from the fan for another 8 h at room temperature. The vials of medium were kept at 4 °C (for no more than 3 days) before the experiment.

Determination of mouse running capacity and grip strength

The maximal running capacity was determined as previously described^12,111, but with minor modifications. In brief, mice were trained on a Rodent Treadmill NG (UGO Basile, 47300) for 3 days during the normal light–dark cycle, and tests were performed during the dark period. Before the experiment, mice were fasted for 2 h. The treadmill was set at a 5° incline, and the speed of the treadmill was set to increase in a ramp mode (commencing at a speed of 5 m min^–1 followed by an increase to a final speed of 25 m min^–1 within 120 min). Mice were considered to be exhausted and removed from the treadmill following 5 or more shocks (0.1 mA) per min for 2 consecutive minutes. The distances travelled were recorded as the running capacity.

Grip strength was determined using a grip strength meter (Ugo Basile, 47200) following a previously described protocol⁹⁶. In brief, the mouse was held by its tail and lowered (‘landed’) until the forelimb or all four limbs grasped the T‐bar connected to a digital force gauge. The mouse was further lowered to the extent that the body was horizontal to the apparatus and was then slowly, steadily drawn away from the T‐bar until the forelimb or all four limbs were removed from the bar, which gave rise to the peak force in grams. Each mouse was tested 5 times with 5-min intervals between measurements.

Determination of body composition

Lean and fat body mass were measured using quantitative magnetic resonance (EchoMRI-100H Analyzer; Echo Medical Systems) as previously described⁷⁸. In brief, the system was calibrated with an oil standard before measurement. Mice were individually weighed and inserted into a restrainer tube and were immobilized by gently inserting a plunger. The mouse was then positioned so that it curled up like a doughnut, with its head against the end of the tube. The body composition of each mouse was measured with three repeated runs, and the average values were taken for further analysis.

Determination of EE

Mouse EE was determined using a metabolic cage system (Promethion Line, CAB-16-1-EU; Sable Systems International) as previously described¹¹². In brief, the system was maintained in a condition identical to that for housing mice. Each metabolic cage in the 16-cage system consisted of a cage with standard bedding, a food hopper and a water bottle connected to load cells for continuous monitoring. To minimize stress to the new environment, mice were acclimated (by individual housing in the gas-calibrated chamber) for 1 week before data collection. Mice treated with LCA or vehicle control were randomly assigned and housed to prevent systematic errors in measurement. Body weights and fat proportion of mice were determined before and after the acclimation period, and the food intake and water intake were measured daily. Mice that did not acclimate to the metabolic cage (for example, they resisted eating or drinking) were removed from the study. Data acquisition (5-min intervals in each cage) and instrument control were performed using MetaScreen software (v.2.3.15.12, Sable Systems) and raw data were processed using Macro Interpreter (v.2.32, Sable Systems). Ambulatory activity and position were monitored using xyz beam arrays with a beam spacing of 0.25 cm (beam breaks), and the mouse distance walked within the cage was calculated accordingly. Respiratory gases were measured using a GA-3 gas analyser (Sable Systems) equipped with a pull-mode, negative-pressure system. Air flow was measured and controlled using a FR-8 (Sable Systems), with a set flow rate of 2,000 ml min^–1. Oxygen consumption (VO₂) and carbon dioxide production (VCO₂) are reported in ml min^–1 values. Water vapour was measured continuously, and its dilution effect on O₂ and CO₂ was compensated mathematically in the analysis stream. EE was calculated using kcal h^–1 = 60 × (0.003941 × VO₂ + 0.001106 × VCO₂) (Weir equation). Differences in average EE were analysed by analysis of covariance using body weight as the covariate. The RQ was calculated as VCO₂/VO₂.

Histology

Muscle fibre types were determined as previously described^74,113. In brief, muscle tissue samples were excised, followed by freezing in isopentane (pre-chilled in liquid nitrogen) for 2 min (until they appeared chalky white). The tissue samples were then quickly transferred to embedding moulds containing OCT compound and were frozen in liquid nitrogen for another 10 min. The embedded tissue samples were then sectioned into 6-μm slices at −20 °C using a CM1950 Cryostat (Leica), followed by fixing in 4% paraformaldehyde for 10 min and washing with running water for 5 min at room temperature. After incubating with PBST (PBS supplemented with 5% (v/v) Triton X-100) for 10 min, the sections were blocked with BSA solution (PBS containing 5% (m/v) BSA) for 30 min at room temperature. Muscle fibres were stained with an antibody against MHCIIb (6 μg ml^–1, diluted in BSA solution) overnight at 4 °C, followed by washing with PBS 3 times, 5 min each at room temperature. The sections were then incubated with Alexa Fluor 488-conjugated, goat anti-mouse IgM antibody (1:200 diluted in BSA solution) for 1 h at room temperature in a dark humidified chamber, followed by washing with PBS for 3 times, 5 min each, incubating in 4% paraformaldehyde for 2 min and then washing with PBS twice, 5 min each, all at room temperature. The sections were then incubated with an antibody against MHCI (6 μg ml^–1, diluted in BSA solution) for 3 h at room temperature in a dark humidified chamber, followed by washing with PBS buffer 3 times, 5 min each at room temperature and then incubated with Alexa Fluor 594-conjugated, goat anti-mouse IgG2b antibody (1:200 diluted in BSA solution) for another 1 h at room temperature in a dark humidified chamber, followed by washing with PBS buffer for 3 times, 5 min each at room temperature. After fixing in 4% paraformaldehyde for 2 min and washing with PBS twice, 5 min each at room temperature, the sections were incubated with an antibody against MHCIIa (6 μg ml^–1, diluted in BSA solution) for 3 h at room temperature in a dark humidified chamber, followed by washing with PBS buffer 3 times, 5 min each at room temperature and then incubating in Alexa Fluor 647-conjugated goat anti-mouse IgG1 antibody (1:200 diluted in BSA solution) for another 1 h at room temperature in a dark humidified chamber, followed by washing with PBS buffer for 3 times, 5 min each at room temperature. Tissue sections were mounted in 90% glycerol and visualized on a LSM980 microscope (Zeiss). Images were processed and analysed using Zen 3.4 software (Zeiss) and formatted using Photoshop 2023 software (Adobe).

C.
elegans strains

Nematodes (hermaphrodites) were maintained on NGM plates spread with E. coli OP50 as standard food. All worms were cultured at 20 °C. WT (N2 Bristol) and sir–2.1 (VC199) strains were obtained from the Caenorhabditis Genetics Center, and sir–2.2 (tm2673) was from the National BioResource Project. All mutant strains were outcrossed six times to N2 before experiments. Unless stated otherwise, worms were maintained on NGM plates spread with E. coli OP50 as standard food. The administration of LCA was initiated at the L4 stage.

The sir–2.1/sir–2.2 double-knockout strain was generated by crossing sir–2.1 knockout with sir–2.2 knockout strains. Before crossing, sir–2.1 knockout hermaphrodites were synchronized. Worms were washed off from agar plates with 15 ml M9 buffer (22.1 mM KH₂PO₄, 46.9 mM Na₂HPO₄, 85.5 mM NaCl and 1 mM MgSO₄) supplemented with 0.05% (v/v) Triton X-100 per plate, followed by centrifugation at 1,000g for 2 min. The worm sediment was suspended with 6 ml M9 buffer containing 50% synchronizing bleaching solution (by mixing 25 ml NaClO solution (5% active chlorine), 8.3 ml of 25% (w/v) NaOH and 66.7 ml M9 buffer for a total of 100 ml), followed by vigorous shaking for 2 min and centrifugation for 2 min at 1,000g. The sediment was washed with 12 ml M9 buffer twice, then suspended with 6 ml M9 buffer, followed by rotating at 20 °C, 30 r.p.m. for 12 h. The synchronized worms were then transferred to NGM plates and cultured to the L4 stage, followed by heat-shocking at 28 °C for 12 h. The heat-shocked worms were then cultured at 20 °C for 4 days, and the males were mated with sir–2.1 knockout hermaphrodites for another 36 h. The mated hermaphrodites were transferred to new NGM plates and allowed to give birth to more sir–2.1 knockout males for another 4 days at 20 °C. The sir–2.1 knockout males were then picked and co-cultured with sir–2.2 knockout hermaphrodites at a 1:2 ratio (for example, 4 males and 8 hermaphrodites on a 10-cm NGM plate) for mating for 36 h at 20 °C, and the mated hermaphrodites (sir–2.2 knockout) were picked for culturing for another 2 days. The offspring were then picked and were individually cultured on 35-mm NGM plates, followed by being individually subjected to genotyping after egg laying (after culturing for approximately 2 days). For genotyping, individual worms were lysed with 5 μl of single worm lysis buffer (50 mM HEPES, pH 7.4, 1 mM EGTA, 1 mM MgCl₂, 100 mM KCl, 10% (v/v) glycerol, 0.05% (v/v) NP-40, 0.5 mM DTT and protease inhibitor cocktail). The lysates were then frozen at −80 °C for 12 h, followed by incubating at 65 °C for 1 h and 95 °C for 15 min on a thermocycler (XP Cycler, Bioer). The lysates were then cooled to room temperature, followed by amplifying genomic DNA on a thermocycler with the following programs: pre-denaturing at 95 °C for 10 min; denaturing at 95 °C for 10 s, then annealing and extending at 60 °C for 30 s in each cycle; cycle number: 35. Primer sequences are as follows: C. elegans sir–2.1, 5′-GAATCGGCTCGTTGCAAGTC-3′ and 5′-AGTTGTGGAATGTCATGGATCCT-3′; and C. elegans sir–2.2, 5′-TACCGCTCGAAAGATGTGGG-3′ and 5′-CTGGAGCCACGTGTTCTTCT-3′. The offspring generated from sir–2.1 and sir–2.2 knockout confirmed individuals were then outcrossed six times to the N2 strain.

The sir–2.3 and sir–2.4 genes were then knocked down in the sir–2.1/sir–2.2-double knockout strain following previously described procedures¹⁵. In brief, synchronized worms (around the L1 stage) were placed on RNAi plates (NGM containing 1 mg ml^–1 IPTG and 50 μg ml^–1 carbenicillin) spread with HT115 E. coli stains containing RNAi against sir–2.3 and sir–2.4 (well C10 on plate X6, and well K04 on plate I9 from the Ahringer C. elegans RNAi Collection) for 2 days. The knockdown efficiency was then examined by determining the levels of sir–2.3 and sir–2.4 mRNA levels by qPCR, in which approximately 1,000 worms were washed off from an RNAi plate with 15 ml M9 buffer containing Triton X-100, followed by centrifugation for 2 min at 1,000g. The sediment was then washed with 1 ml M9 buffer twice and then lysed with 1 ml of TRIzol. The worms were then frozen in liquid nitrogen, thawed at room temperature and then subjected to repeated freeze–thaw for another two times. The worm lysates were then placed at room temperature for 5 min, then mixed with 0.2 ml chloroform followed by vigorous shaking for 15 s. After 3 min, lysates were centrifuged at 20,000g at 4 °C for 15 min, and 450 μl of the aqueous phase (upper layer) was transferred to a new RNase-free centrifuge tube (Biopur, Eppendorf), followed by mixing with 450 μl of isopropanol then centrifuging at 20,000g at 4 °C for 10 min. The sediments were washed with 1 ml of 75% ethanol (v/v) followed by centrifugation at 20,000 g for 10 min, and then washed with 1 ml anhydrous ethanol followed by centrifugation at 20,000g for 10 min. The sediments were then dissolved with 20 μl RNase-free water after the ethanol had evaporated. The dissolved RNA was then reverse-transcribed to cDNA using ReverTra Ace qPCR RT master mix with a gDNA Remover kit, followed by performing real-time qPCR using Maxima SYBR Green/ROX qPCR master mix on a CFX96 thermocycler (Bio-Rad) with the programs as described for genotyping the sir–2.1/2.2 knockout strain. Primer sequences are as follows: sir–2.3, 5′-ACTCTCTCGCCTGTGCAAAT-3′ and 5′-ACTTCCAACGATGTCCCAAG-3′; and sir–2.4, 5′-GCCGTAAAAAGTTTGAGCCC-3′ and 5′-TTTCCATGCTTTTCGGATT-3′. Data were analysed using CFX Manager software (v.3.1, Bio-Rad). Knockdown efficiency was evaluated according to the CT values obtained.

The tub–1 knockout nematode strains expressing human TULP3 or TULP3(4G) were established through a three-step strategy as previously described¹⁵, but with minor modifications. (1) TULP3 or TULP3(4G) was first introduced to the N2 strain; (2) such generated strains were then subjected to knockout of the tub–1 gene; and (3) the tub–1-knockout worms were then picked for further outcrossing with the N2 strain. In brief, to generate the N2 strain expressing TULP3 or TULP3(4G), cDNAs were inserted into a pJM1 vector, with GFP as a selection marker, between the Nhe I and Kpn I sites (expressed under control by a sur–5 promoter), and then injected into the syncytial gonad of the worm (200 ng µl^–1, 0.5 µl per worm) following a previously described procedure¹⁵. The injected worms were then recovered on an NGM plate for 2 days, and the F₁ GFP-expressing hermaphrodites were selected for further culture. The extrachromosomal TULP3 or TULP(S4G) expression plasmid was then integrated into the nematode genome using UV irradiation to establish non-mosaic transgenic strains as previously described¹¹⁴, but with minor modifications. In brief, 70 TULP3-expressing or TULP3(4G)-expressing worms at the L4 stage were picked and incubated with 600 µl M9 buffer, followed by the addition of 10 µl TMP solution (3 mg ml^–1 stock concentration in DMSO) and rotating at 30 r.p.m. for 15 min in the dark. Worms were then transferred to a 10-cm NGM plate without OP50 bacteria in the dark, followed by irradiating with UV at a total dose of 35 J cm^–2 (exposed for 35 s) on a UV crosslinker (CL-508; UVITEC). The irradiated worms were fed with 1 ml OP50 bacteria at 10¹³ per ml concentration and then cultured at 20 °C for 5 h in the dark, followed by individual culture on a 35-mm NGM plate for 1 week without transferring to any new NGM plate (to ensure that the F₁ generation was under starvation conditions before further selection). The F₁ GFP-expressing hermaphrodites were selected and individually cultured for another 2 days, and the F₂ 100% GFP-expressing hermaphrodites were selected for further culture. The genomic sequence encoding tub–1 was then knocked out from this strain by injecting a mixture of a pDD122 (Peft–3::Cas9 + ttTi5605 sgRNA) vector carrying sgRNAs targeting tub–1 (5′-ATAGCTGATCAAAAGTTCTA-3′ for intron 2 and 5′-GAGAGCGGTCAGTGACACGG-3′ for intron 7; inserted into a pDD122 vector with the ttTi5605 sgRNA sequence replaced), which were designed using the CHOPCHOP website (http://chopchop.cbu.uib.no/), into young adult worms. The F₁ hermaphrodite worms were individually cultured on an NGM plate. After egg laying, worms were lysed using single worm lysis buffer, followed by PCR with the programs as described for genotyping the sir–2.1/2.2 knockout strain, and the primers 5′-GAGTAATTTTCGGCATTTGTGC-3′ and 5′-CGAGAAGCTCATTTCAAGGTTT-3′ were used. The offspring generated from knockout-confirmed individuals were outcrossed six times to the N2 strain, and the expression levels of TULP3 or TULP3(4G) were examined by IB. Strains expressing TULP3 or TULP3(4G) at similar levels were chosen for further experiments.

Nematode strain (N2) with human V1E1 or V1E1(3KR) expression was constructed as described above, except that cDNAs of human V1E1 or V1E1(3KR) were used, and that the sur–5 promoter on the pJM1 vector was replaced by the promoter of V1E1 (vha-8) itself (by replacing the sequence between Asc I and Fse I sites with the annealed primer pair 5′-CTGACTGGGCCGGCCCTTAGAGATAGACTGTGGTC-3′ and 5′-CTCTAGAGGCGCGCCGACATTTAATAAAATAATCATTTTTC-3′). The presence of V1E1 or V1E1(3KR) was validated by sequencing using the primer 5′-ATGGCTCTCAGCGATGCTGA-3′.

For all nematode experiments, worms at the L4 stage were used.

Evaluation of lifespan and healthspan in nematodes

To determine the lifespan of nematodes, the worms were first synchronized. Synchronized worms were cultured to the L4 stage before transfer to desired agar plates for determining lifespan. Worms were transferred to new plates every 2 days. Live and dead worms were counted during the transfer. Worms that displayed no movement after gentle touching with a platinum picker were judged as dead. Kaplan–Meier curves were generated using Prism 9 (GraphPad Software), and statistical analysis was performed using SPSS 27.0 (IBM).

The resistance of nematodes to oxidative stress was determined as previously described⁹⁴. In brief, synchronized worms were cultured to the L4 stage, after which LCA was administered. After 2 days of LCA treatment, 20 worms were transferred to a NGM plate containing 15 mM FeSO₄. Worms were then cultured at 20 °C, during which the live and dead worms were counted every 1 h.

D.
melanogaster strains

All flies were cultured at 25 °C and 60% humidity with a 12-h light–dark cycle. Adult flies were cultured in BDSC standard cornmeal medium (for regular culture) agar diet. Larvae and the crossed fly strains were reared on a semi-defined, rich medium, which was prepared as previously described¹¹⁵, but with minor modifications. In brief, 10 g agar, 80 g dry yeast, 20 g yeast extract, 20 g peptone, 30 g sucrose, 60 g glucose, 0.5 g MgSO₄·6H₂O and 0.5 g CaCl₂·6H₂O were dissolved in 1,000 ml di-distilled water and then boiled, followed by cooling to 60 °C. Next, 6 ml propionic acid was added to the medium, and the medium was dispensed into culture vials (6 ml each). The vials of medium were covered with gauze and blown with a breeze as described above and were kept at 20 °C (for no more than 3 days) before experiments. Fly embryos were prepared using grape juice plates. The plates were prepared by mixing 30 g agar in 1 l water, followed by boiling in a microwave for 3 rounds, 3 min per round. Next, 360 ml grape juice, 2 g methyl paraben and 30 g sucrose were then sequentially added to the agar solution, with each component mixed thoroughly on a heated magnetic stirrer. The medium was dispensed into 100-cm Petri dishes, 10 ml each, and was kept at 4 °C (for no more than 1 week) before experiments. The yeast paste used for collecting embryos was freshly prepared by thoroughly mixing 7 g dry yeast with 9 ml water in a 50-ml conical flask with a metal spatula until it reached the consistency of peanut butter. The paste was then dabbed at the centre of each grape juice plate before experiments.

The WT fly strain (w¹¹¹⁸; 3605), Sir2^4.5 strain (Sirt1^4.5 cn¹/SM6b, P{ry^+t7.2=eve-lacZ8.0}SB¹; 32568), Sir2^5.26 strain (Sirt1^5.26 cn¹; 32657), Cas9-expressing strain (y¹ sc^* v¹ sev²¹; P{y^+t7.7 v^+t1.8=nanos–Cas9.R}attP2; 78782), Bloomington DB strain (w¹¹¹⁸; wg^Sp-1/CyO; MKRS/TM6B, Tb¹; 76357) and the GAL4-expressing strain (y¹ w^*; P{Act5C-GAL4-w}E1/CyO; 25374) were obtained from the BDSC. The GAL4-induced, ktub RNAi-carrying strain (w¹¹¹⁸; P{GD14210}v29111; 29111) was obtained from the Vienna Drosophila Resource Center. The ywR13S strain (yw; Sp/CyO; MKRS/TM2), CAS DB strain (w¹¹¹⁸; BL1/CyO; TM2/TM6B), attp3# (68A4) strain (y¹ M{vas–int.Dm}ZH–2A w^*; P{CaryP}attP2) and the attp2# (25C6) strain (y¹ M{vas–int.Dm}ZH–2A w^*; P{CaryP}attP40) were obtained from the Core Facility of Drosophila Resource and Technology, Chinese Academy of Sciences. Files with Sir2 knockout were obtained by crossing the Sir2^4.5 and the Sir2^5.26 strains, followed by picking the F₁ offspring with red eyes and straight wings (Sir2^4.5/Sir2^5.26). Flies with GAL4 expressed on the w¹¹¹⁸ background (w¹¹¹⁸; P{Act5C-GAL4-w}E1/CyO) were first generated as previously described¹ by crossing the y¹ w^*; P{Act5C-GAL4-w}E1/CyO males with w¹¹¹⁸; Sp/CyO females, followed by crossing the F₁ males with straight wings (w¹¹¹⁸; P{Act5C-GAL4-w}E1/Sp) with w¹¹¹⁸; Sp/CyO females.

To generate ktub (CG9398) knockout flies, the synchronized (see the section ‘Evaluation of lifespan and healthspan of flies’ for details), Cas9-expressing flies were housed in a collection cage (59-101; Genesee Scientific) containing a grape juice plate for 2 days. Flies were then allowed to lay embryos for 3 rounds, with each round lasting for 1 h, on a fresh grape juice plate that contained a dab of yeast paste at the centre. Next, 800 embryos were collected by filling each grape juice plate with water, followed by gently dislodging the embryos with a paintbrush and then filtering the solution by passing through a 70-μm cell strainer (350350; Falcon). The embryos in the strainer were then vigorously rinsed with tap water at 2 ml s^–1 3 times, 30 s each, followed by rough drying on a paper towel. The embryos were then dechorionated by dipping the strainer into freshly prepared 50% bleach solution (diluted in water) filled in a 10-cm Petri dish for 1 min, followed by rinsing with tap water at 2 ml s^–1 for 3 times, 30 s each. After roughly drying on a paper towel, embryos were aligned with their ventral side sitting on a segment of double-sided tape (665; 3M Scotch) that was stuck onto a slide, followed by covering with a drop of mineral oil (1:1; Halocarbon oil 700 to Halocarbon oil 27). Next, 2 nl of 500 ng μl^–1 gRNAs targeting exon 3 of ktub (5′-CGCATTACGCGGGACAGGAA-3′ and 5′-CGGAGATCTCATCGCACGAGT-3′) were then injected into the posterior pole of the embryo following previously described procedures¹⁵. The injected embryos were cultured at 18 °C for 48 h on a IHC transparent humidified chamber, and the larvae were then transferred to the semi-defined, rich medium and cultured at 25 °C for another week for the F₀ adults. The F₀ adults were then individually mated with ywR13S adults, and any F₁ offspring with straight wings were discarded. The remaining F₁ female offspring with curled wings were then screened for the presence of ktub knockout through genotyping following the procedures outlined in the section ‘Analysis of mitochondrial DNA copy numbers in mice, nematodes and flies’, with the following primers: 5′-AGATCAATCGACCCATGTCCG-3′ and 5′-CTTGCCGTAGTCACGTTCCA-3′. The F₁ male, curled-wing offspring (possibly with the yw; ktub^–/–/CyO; +/TM2 genotype) from those female counterparts with ktub knockout were individually mated with virgin females of the CAS DB strain. After 4 days of mating, each F₁ male was subjected to genotyping with the ktub knockout, and the F₂ male offspring (possibly the w¹¹¹⁸; ktub^–/–/CyO; +/TM6B genotype) generated from those ktub-knockout-confirmed F₁ males were picked and mated again with virgin females of the CAS DB strain. The F₃ male, curled-wing offspring (possibly the w¹¹¹⁸; ktub^–/–/CyO; +/TM6B genotype) were then individually mated with virgin females of F₃ curled-wing offspring. After 10 days of mating, each pair of F₃ male and female flies were subjected to examination for ktub knockout, and the F₄ offspring generated from the breeding of these F₃ males and females with ktub knockout were selected to breed with each other, leading to the generation of ktub^–/– (w¹¹¹⁸; ktub^–/–/ktub^–/–) flies.

Human TULP3(4G) was re-introduced to the ktub^–/– flies by expressing TULP3(4G) in the attp3# flies (with TULP3 inserted into chromosome III). The modified flies were then sequentially crossed with ywR13S and DB flies to backcross to a w¹¹¹⁸ background, followed by crossing with the ktub^–/– flies. In brief, to generate attp3# flies with TULP3(4G) expression, cDNA encoding TULP3(4G) was inserted into a pUAST-attB vector between the Xho I and Xba I sites. The construct was then injected into the embryos of attp3# flies as for sgRNA injection, except that the concentration was 300 ng μl^–1. The F₀ adults were then individually mated with ywR13S flies, and the F₁ males with curled wings and orange eyes (possibly the yw; +/CyO; TULP3–4G/TM2 genotype) were mated with the virgin females of the CAS DB strain. The F₂ males with curled wings and white eyes (w¹¹¹⁸; +/CyO; TULP3–4G/TM6B) were mated with virgin females of the CAS DB strain again, followed by crossing the F₃ males with curled wings and white eyes with F₃ virgin females with curled wings and white eyes to generate the TULP3(4G)-expressing (w¹¹¹⁸; +/+; TULP3–4G/TM6B) flies. The TULP3(4G)-expressing strains and the ktub^–/– strains were separately crossed with Bloomington DB flies. The F₁ offspring of TULP3(4G) with curled wings (w¹¹¹⁸; +/CyO; TULP3–4G/MKRS) and the F₁ offspring of ktub^–/– with additional bristles in the humerus (w¹¹¹⁸; ktub^–/–/wg^Sp-1; +/TM6B, Tb¹), were then mated together, and the F₂ offspring with curled wings and additional bristles in the humerus (possibly the w¹¹¹⁸; ktub^–/–/Cyo; TULP3–4G/TM6B, Tb¹) were picked. The expression of TULP3(4G) was achieved by crossing the picked F₂ offspring with the GAL4-expressing strain (w¹¹¹⁸; P{Act5C-GAL4-w}E1/CyO), and the F₃ offspring with straight wings and regular bristles (w¹¹¹⁸; P{Act5C-GAL4-w}E1/ktub^–/–; TULP3–4G/+) were used for further experiments. The TULP3-re-introduced, ktub^–/– flies were similarly generated, except that TULP3 cDNA was used.

The human V1E1(3KR) was introduced to the WT flies as for TULP3, except that the attp2# strain (with V1E1 inserted into chromosome II) was used as the acceptor. The F₀ adults were then sequentially mated with ywR13S flies, CAS DB flies, the F₂ offspring themselves and the GAL4-expressing strain as for TULP3. The w¹¹¹⁸; P{Act5C-GAL4-w}E1/V1E1–3KR flies were used for further experiments.

Evaluation of lifespan and healthspan of flies

Fly lifespan was determined as previously described¹¹⁶, but with minor modifications. Before the experiment, flies were synchronized. Approximately 200 pairs of flies, housed 10 pairs per tube, were cultured in semi-defined, rich medium and allowed to lay eggs for a day. After discarding the parent flies, the embryos were cultured for another 10 days, and the flies that eclosed at day 12 were anaesthetized and collected with CO₂ (those that emerged before day 12 were discarded), followed by transferring to BDSC standard cornmeal medium and cultured for another 2 days. The male and female adults were then sorted by briefly anaesthetizing with CO₂ on an anaesthetic pad using a homemade feather brush (by attaching the apical region of a vane from the secondary coverts of an adult goose to a plastic balloon stick), and 200 adults of each group and sex were randomly assigned to BDSC standard cornmeal medium, with or without LCA, with 20 flies per tube. The files were transferred to new medium tubes every 2 days without anaesthesia until the last survivor was dead. During each tube transfer, the sum of dead flies in the old tubes and the dead flies carried to the new tubes were recorded as the numbers of deaths, and the escaped or accidentally killed flies (that is, died within 3 days of same-sex culturing or squeezed by the tube plugs) were censored from the experiments. Kaplan–Meier curves were generated using Prism 9 (GraphPad Software), and statistical analysis was performed using SPSS 27.0 (IBM).

The resistance of flies to oxidative stress was determined as previously described¹¹⁷. In brief, synchronized adults were treated with LCA for 30 days, followed by transfer to vials (20 flies each), each containing a filter paper soaked with 20 mM paraquat or 5% (m/v) H₂O₂ dissolved or diluted in 5% (w/v, in water) glucose solution. To determine the resistance of flies to starvation (food deprivation), flies treated with LCA for 30 days were transferred to vials with culture medium replaced by the same volume of 1.5% agarose to remove the food supply. Dead files were recorded every 2 h until the last survivor was dead.

Quantification of mRNA levels of mitochondrial genes in mice, nematodes and flies

Mice treated with LCA were killed by cervical dislocation, immediately followed by dissecting the gastrocnemius muscle. The muscle tissue was roughly sliced into cubes (with edge lengths of approximately 2 mm) and then soaked in RNAprotect tissue reagent (1 ml per 100 mg of tissue) for 24 h at room temperature. The tissue was then incubated in 1 ml TRIzol, followed by three rounds of freeze–thaw cycles and was then homogenized. The homogenate was centrifuged at 12,000g for 15 min at 4 °C, and 900 µl of clear supernatant (not the lipid layer on the top) was transferred to a RNase-free tube. Next, 200 µl chloroform was added to the supernatant, followed by a vigorous vortex for 15 s. After centrifugation at 12,000g for 15 min at 4 °C, 450 µl of the upper aqueous layer was transferred to a RNase-free tube. The RNA was then precipitated by adding 450 µl isopropanol, followed by centrifugation at 12,000g for 30 min at 4 °C. The pellet was washed twice with 75% ethanol and once with 100% ethanol, and was dissolved with 20 µl DEPC-treated water. The concentration of RNA was determined using a NanoDrop 2000 spectrophotometer (Thermo). Next, 1 µg of RNA was diluted with DEPC-treated water to a final volume of 10 µl, heated at 65 °C for 5 min and immediately chilled on ice. Random primer mix, enzyme mix and 5× RT buffer (all from the ReverTra Ace qPCR RT master mix) were added to the RNA solution, followed by incubation at 37 °C for 15 min and then at 98 °C for 5 min on a thermocycler. The reverse-transcribed cDNA was quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II system (Roche) with the following programs: pre-denaturing at 95 °C for 10 min; denaturing at 95 °C for 10 s, then annealing and extending at 65 °C for 30 s in each cycle (determined according to the amplification curves, melting curves and bands on agarose gel of serial pilot reactions (in which a serial annealing temperature was set according to the estimated annealing temperature of each primer pair) of each primer pair, and same hereafter), for a total of 45 cycles. Primer pairs for mouse Nd1, Nd2, Nd3, Nd4, Nd4l, Nd5, Nd6, Ndufab1, Cytb, Uqcrc1, Uqcrc2, Atp5f1b, Cox6a1, Atp6, Atp8, Cox1 and Cox3 were generated as previously described¹¹⁸, and others were generated using the Primer-BLAST website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). Mouse primer sequences are as follows: Gapdh, 5′-GACTTCAACAGCAACTCCCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′; Nd1, 5′-TGCACCTACCCTATCACTCA-3′ and 5′-C GGCTCATCCTGATCATAGAATGG-3′; Nd2, 5′-ATACTAGCAATTACTTCTATTTTCATAGGG-3′ and 5′-GAGGGATGGGTTGTAAGGAAG-3′; Nd3, 5′-AAGCAAATCCATATGAATGCGG-3′ and 5′-GCTCATGGTAGTGGAAGTAGAAG-3′; Nd4, 5′-CCTCAGACCCCCTATCCACA-3′ and 5′-GTTTGGTTCCCTCATCGGGT-3′; Nd4l, 5′-CCAACTCCATAAGCTCCATACC-3′ and 5′-GATTTTGGACGTAATCTGTTCCG-3′; Nd5, 5′-ACGAAAATGACCCAGACCTC-3′ and 5′-GAGATGACAAATCCTGCAAAGATG-3′; Nd6, 5′-TGTTGGAGTTATGTTGGAAGGAG-3′ and 5′-CAAAGATCACCCAGCTACTACC-3′; Tfam, 5′-GGTCGCATCCCCTCGTCTAT-3′ and 5′-TTGGGTAGCTGTTCTGTGGAA-3′; Cs, 5′-CTCTACTCACTGCAGCAACCC-3′ and 5′-TTCATGCCTCTCATGCCACC-3′; Ndufs8, 5′-TGGCGGCAACGTACAAGTAT-3′ and 5′-GTAGTTGATGGTGGCAGGCT-3′; Ndufab1, 5′-GGACCGAGTTCTGTATGTCTTG-3′ and 5′-AAACCCAAATTCGTCTTCCATG-3′; Ndufb10, 5′-TGCCAGATTCTTGGGACAAGG-3′ and 5′-GTCGTAGGCCTTCGTCAAGT-3′; Ndufv3, 5′-GTGTGCTCAAAGAGCCCGAG-3′ and 5′-TCAGTGCCGAGGTGACTCT-3′; Ndufa8, 5′-GCGGAGCCTTTCACAGAGTA-3′ and 5′-TCAATCACAGGGTTGGGCTC-3′; Ndufs3, 5′-CTGACTTGACGGCAGTGGAT-3′ and 5′-CATACCAATTGGCCGCGATG-3′; Ndufa9, 5′-TCTGTCAGTGGAGTTGTGGC-3′ and 5′-CCCATCAGACGAAGGTGCAT-3′; Ndufa10, 5′-CAGCGCGTGGGACGAAT-3′ and 5′-ACTCTATGTCGAGGGGCCTT-3′; Sdha, 5′-AGGGTTTAATACTGCATGCCTTA-3′ and 5′-TCATGTAATGGATGGCATCCT-3′; Sdhb, 5′-AGTGCGGACCTATGGTGTTG-3′ and 5′- AGACTTTGCTGAGGTCCGTG-3′; Sdhc, 5′-TGAGACATGTCAGCCGTCAC-3′ and 5′-GGGAGACAGAGGACGGTTTG-3′; Sdhd, 5′-TGGTACCCAGCACATTCACC-3′ and 5′-GGGTGTCCCCATGAACGTAG-3′; Cytb, 5′-CCCACCCCATATTAAACCCG-3′ and 5′-GAGGTATGAAGGAAAGGTATTAGGG-3′; Uqcrc1, 5′-ATCAAGGCACTGTCCAAGG-3′ and 5′-TCATTTTCCTGCATCTCCCG-3′; Uqcrc2, 5′-TTCCAGTGCAGATGTCCAAG-3′ and 5′-CTGTTGAAGGACGGTAGAAGG-3′; Atp5f1b, 5′-CCGTGAGGGCAATGATTTATAC-3′ and 5′-GTCAAACCAGTCAGAGCTACC-3′ Cox6a1, 5′-GTTCGTTGCCTACCCTCAC-3′ and 5′- TCTCTTTACTCATCTTCATAGCCG-3′; Atp6, 5′-TCCCAATCGTTGTAGCCATC-3′ and 5′-TGTTGGAAAGAATGGAGTCGG-3′; Atp8, 5′-GCCACAACTAGATACATCAACATG-3′ and 5′-TGGTTGTTAGTGATTTTGGTGAAG-3′; Atp5f1a, 5′-CATTGGTGATGGTATTGCGC-3′ and 5′-TCCCAAACACGACAACTCC-3′; Cox1, 5′-CCCAGATATAGCATTCCCACG-3′ and 5′- ACTGTTCATCCTGTTCCTGC-3′; Cox2, 5′-TCTACAAGACGCCACATCCC-3′ and 5′-ACGGGGTTGTTGATTTCGTCT-3′; Cox3, 5′-CGTGAAGGAACCTACCAAGG-3′ and 5′-CGCTCAGAAGAATCCTGCAA-3′; Cox5b, 5′-AGCTTCAGGCACCAAGGAAG-3′ and 5′-TGGGGCACCAGCTTGTAATG-3′. The mRNA level was then calculated using the comparative ΔΔct method and LightCycler software (v.96 1.1, Roche; same hereafter for all qPCR experiments).

Nematodes at the L4 stage treated with LCA for 1 day were used for the analysis of mitochondrial gene expression. About 1,000 worms were collected with 15 ml M9 buffer containing 0.05% Triton X-100 (v/v), followed by centrifugation for 2 min at 1,000g. The sediment was washed with 1 ml M9 buffer twice and then lysed with 1 ml TRIzol. Worms were then frozen in liquid nitrogen, thawed at room temperature and the freeze–thaw process was repeated for another 2 times. The worm lysates were then placed at room temperature for 5 min, mixed with 0.2 ml of chloroform, followed by vigorous shaking for 15 s. After centrifugation at 12,000g for 15 min at 4 °C, 450 µl of the upper aqueous layer was transferred to a RNase-free tube. The RNA was then precipitated by adding 450 µl of isopropanol, followed by centrifugation at 12,000g for 30 min at 4 °C. The pellet was washed twice with 75% ethanol and once with 100% ethanol, and was dissolved with 20 µl DEPC-treated water. The concentration of RNA was determined using a NanoDrop 2000 spectrophotometer (Thermo). Next, 1 µg of RNA was diluted with DEPC-treated water to a final volume of 10 µl, heated at 65 °C for 5 min and immediately chilled on ice. Random primer mix, enzyme mix and 5× RT buffer (all from the ReverTra Ace qPCR RT master mix) were then added to the RNA solution, followed by incubation at 37 °C for 15 min and then at 98 °C for 5 min on a thermocycler. The reverse-transcribed cDNA was quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II System (Roche) with the following programs: pre-denaturing at 95 °C for 10 min; denaturing at 95 °C for 10 s, then annealing and extending at 65 °C for 30 s in each cycle (determined according to the amplification curves, melting curves, and bands on agarose gel of serial pilot reactions (in which a serial annealing temperature was set according to the estimated annealing temperature of each primer pair) of each primer pair, and same hereafter), for a total of 45 cycles. Primer pairs used for qPCR were as previously described^119,120, except that C. elegans ctb-1 was designed using the Primer-BLAST website. C. elegans primer sequences are as follows: ama-1, 5′-GACATTTGGCACTGCTTTGT-3′ and 5′-ACGATTGATTCCATGTCTCG-3′; nuo-6, 5′-CTGCCAGGACATGAATACAATCTGAG-3′ and 5′-GCTATGAGGATCGTATTCACGACG-3′; nuaf-1, 5′-GAGACA TAACGAGGCTCGTGTTG-3′ and 5′-GAAGCCTTCTTTCCAATCACTATCG-3′; sdha-1, 5′-TTACCAGCGTGCTTTCGGAG-3′ and 5′-AGGGTGTGGAGAAGAGAATGACC-3′; sdhb-1, 5′-GCTGAACGTGATCGTCTTGATG-3′ and 5′-GTAGGATGGGCATGACGTGG-3′; cyc-2.1, 5′-CGGA GTTATCGGACGTACATCAG-3′ and 5′-GTCTCGCGGGTCCAGACG-3′; isp-1, 5′-GCAGAAAGATGAATGGTCCGTTG-3′ and 5′-ATCCGTGACAAGGGCAGTAATAAC-3′; cco-1, 5′-GCTGGAGATGATCGTTACGAG-3′ and 5′-GCATCCAATGATTCTGAAGTCG-3′; cco-2, 5′-GTGATACCGTCTACGCCTACATTG-3′ and 5′-GCTCTGGCACGAAGAATTCTG-3′; atp-3, 5′-GTCCTCGACCCAACTCTCAAG-3′ and 5′-GTCCAAGGAAG TTTCCAGTCTC-3′; nduo-1, 5′-AGCGTCATTTATTGGGAAGAAGAC-3′ and 5′-AAGCTTGTGCTAATCCCATAAATGT-3′; nduo-2, 5′-TCTT TGTAGAGGAGGTCTATTACA-3′ and 5′-ATGTTAAAAACCACATTAGCCCA-3′; nduo-4, 5′-GCACACGGTTATACATCTACACTTATG-3′ and 5′-GATGTATGATAAAATTCACCAATAAGG-3′; nduo-5, 5′-AGATGAGATTTATTGGGTATTTCTAG-3′ and 5′-CACCTAGACGATTAGTTAATGCTG-3′; ctc-1, 5′-GCAGCAGGGTTAAGATCTATCTTAG-3′ and 5′-CTGTTACAAATACAGTTCAAACAAAT-3′; ctc-2, 5′-GTAGTTTATTGTTGGGAGTTTTAGTG-3′ and 5′-CACAATAATTCACCAAACTGATACTC-3′; atp-6, 5′-TGCTGCTGTAGCGTGATTAAG-3′ and 5′-ACTGTTAAAGCAAGTGGACGAG-3′; ctb-1, 5′-TGGTGTTACAGGGGCAACAT-3′ and 5′-TGGCCTCATTATAGGGTCAGC-3′. The mRNA level was then calculated using the comparative ΔΔct method and LightCycler software (v.96 1.1, Roche; same hereafter for all qPCR experiments).

Drosophila adults treated with LCA for 30 days were used to determine the expression of mitochondrial genes. For each sample, 20 adults were used. The adults were anaesthetized, transferred to a 1.5-ml Eppendorf tube, followed by quickly freezing in liquid nitrogen and then homogenized using a pellet pestle (Z359963-1EA, Sigma). The homogenate was then lysed in 1 ml TRIzol for 5 min at room temperature, followed by centrifugation at 12,000g for 15 min at 4 °C. Next, 900 μl of supernatant (without the lipid layer) was transferred to a RNase-free tube, followed by mixing with 200 μl chloroform. After vigorous vortexing for 15 s, the mixture was centrifuged at 12,000g for 15 min at 4 °C, and 450 μl of the upper aqueous layer was transferred to a RNase-free tube. The RNA was then precipitated by adding 450 μl isopropanol, followed by centrifugation at 12,000g for 30 min at 4 °C. The pellet was washed twice with 75% (v/v, in water) ethanol and was dissolved with 20 μl of DEPC-treated water. The concentration of RNA was determined using a NanoDrop 2000 spectrophotometer (Thermo). Next, 1 µg of RNA was diluted with DEPC-treated water to a final volume of 10 µl, heated at 65 °C for 5 min and immediately chilled on ice. Random primer mix, enzyme mix and 5× RT buffer (all from the ReverTra Ace qPCR RT master mix) were then added to the RNA solution, followed by incubation at 37 °C for 15 min and then at 98 °C for 5 min on a thermocycler. The reverse-transcribed cDNA was quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II system (Roche) with the following programs: pre-denaturing at 95 °C for 5 min; denaturing at 95 °C for 10 s, then annealing at 60 °C for 20 s, and then extending at 72 °C for 20 s in each cycle, for a total of 40 cycles. D. melanogaster primer pairs used for qPCR were as previously described¹²¹, and are as follows: CG9172, 5′-CGTGGCTGCGATAGGATAAT-3′ and 5′-ACCACATCTGGAGCGTCTTC-3′; CG9762, 5′-AGTCACCGCATTGGTTCTCT-3′ and 5′-GAGATGGGGTGCTTCTCGTA-3′; CG17856, 5′-ACCTTTCCATGACCAAGACG-3′ and 5′-CTCCATTCCTCACGCTCTTC-3′; CG18809, 5′-AAGTGAAGACGCCCAATGAGA-3′ and 5′-GCCAGGTACAACGACCAGAAG-3′; CG5389, 5′-ATGGCTACAGCATGTGCAAG-3′ and 5′-GACAGGGAGGCATGAAGGTA-3′; and Act5c, 5′-GCAGCAACTTCTTCGTCACA-3′ and 5′-CATCAGCCAGCAGTCGTCTA-3′.

Analysis of mitochondrial DNA copy numbers in mice, nematodes and flies

Mouse mitochondrial DNA copy numbers were determined as previously described⁷⁸. In brief, mouse tissue DNA was extracted using a Biospin tissue genomic DNA extraction kit (BioFlux) following the manufacturer’s instruction, but with minor modifications. In brief, mice treated with LCA were killed by cervical dislocation, quickly followed by dissecting the gastrocnemius muscle. The muscle tissue was then ground in a ceramic mortar in liquid nitrogen. Next, 50 mg of ground tissue was transferred to a 1.5-ml Eppendorf tube, followed by the addition of 600 µl FL buffer and 10 µl PK solution containing 2 µl of 100 mg ml^–1 RNase A. The mixture was incubated at 56 °C for 15 min, followed by centrifugation at 12,000 g for 3 min. Next, 500 µl of supernatant was transferred to a 2-ml Eppendorf tube, followed by mixing with 700 µl binding buffer and 300 µl absolute ethanol. The mixture was then loaded onto a Spin column and was centrifuged at 10,000g for 1 min. The flowthrough was discarded and 500 µl of the PW buffer was added to the Spin column, followed by centrifugation at 10,000g for 30 s. Next, 600 µl washing buffer was added to the Spin column, followed by centrifugation at 10,000g for 30 s, and the process was repeated again. The Spin column was then centrifuged for 1 min at 10,000g to completely remove the washing buffer, and DNA on the column was eluted with 100 µl of elution buffer (added to the Spin column, followed by incubation at room temperature for 5 min, and then centrifuged at 12,000g for 1 min). Total DNA was quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II system (Roche) with the following programs: 70 ng of DNA was pre-denatured at 95 °C for 10 min and then subjected to PCR for a total of 45 cycles: denaturing at 95 °C for 10 s, annealing and extending at 65 °C for 30 s in each cycle. Mouse primer pairs used for qPCR were as previously described¹²² (Hk2, 5′-GCCAGCCTCTCCTGATTTTAGTGT-3′ and 5′-GGGAACACAAAAGACCTCTTCTGG-3′; and Nd1, 5′-CTAGCAGAAACAAACCGGGC-3′ and 5′-CCGGCTGCGTATTCTACGTT-3′).

Nematode mitochondrial DNA copy numbers were determined from worm lysates as previously described⁷⁸. In brief, 30 synchronized early L4 worms were collected and were lysed with 10 μl single worm lysis buffer. The worm lysate was frozen at −80 °C overnight, followed by incubating at 65 °C for 1 h and 95 °C for 15 min. Nematode DNA was then quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II system (Roche) with the following programs: pre-denaturing at 95 °C for 10 min and then for a total of 45 cycles of denaturing at 95 °C for 10 s, and annealing and extending at 65 °C for 30 s in each cycle. C. elegans primer pairs used for qPCR were designed as previously described⁹⁵ (nd-1, 5′-AGCGTCATTTATTGGGAAGAAGAC-3′ and 5′-AAGCTTGTGCTAATCCCATAAATGT-3′; and act-3, 5′-TGCGACATTGATATCCGTAAGG-3′ and 5′-GGTGGTTCCTCCGGAAAGAA-3′).

Drosophila DNA copy numbers were determined as previously described¹²³, but with minor modifications. In brief, 20 anaesthetized adults were homogenized in 100 μl fly lysis buffer (75 mM NaCl, 25 mM EDTA and 25 mM HEPES, pH7.5) containing proteinase K (100 μg ml^–1). The homogenate was then frozen at −80 °C for 12 h, followed by incubation at 65 °C for 1 h and 95 °C for another 15 min. The fly DNA was then quantified using Maxima SYBR Green/ROX qPCR master mix on a LightCycler 480 II system (Roche) with the following programs: pre-denaturing at 95 °C for 5 min and then for a total of 40 cycles of denaturing at 95 °C for 10 s, and annealing 60 °C for 20 s and extending at 72 °C for 20 s in each cycle. D. melanogaster primer pairs used for qPCR were as previously described¹²³ (16S rRNA, 5′-TCGTCCAACCATTCATTCCA-3′ and 5′-TGGCCGCAGTATTTTGACTG-3′; and RpL32, 5′-AGGCCCAAGATCGTGAAGAA-3′ and 5′-TGTGCACCAGGAACTTCTTGAA-3′).

Measurement of adenylates and NAD⁺

ATP, ADP, AMP and NAD⁺ from cells, tissues or flies were analysed by capillary–MS (CE–MS) as previously described¹⁰, but with minor modifications¹²⁴. In brief, each measurement required MEFs collected from one 10-cm dish (60–70% confluence), 100 mg of liver or muscle tissue dissected by freeze-clamping, or 20 anesthetized adult flies. Before CE–MS analysis, cells were rinsed with 20 ml of 5% (m/v) mannitol solution (dissolved in water) and instantly frozen in liquid nitrogen. Cells were then lysed with 1 ml methanol containing IS1 (50 µM l-methionine sulfone, 50 µM d-campher-10-sulfonic acid, dissolved in water; 1:500 (v/v) added to the methanol and used to standardize the metabolite intensity and to adjust the migration time), and were scraped from the dish. For analysis of metabolites in liver and muscle, mice were anaesthetized after indicated treatments. The tissue was then quickly excised by freeze-clamping and then ground in 1 ml methanol with IS1. For analysis of metabolites in flies, 20 adult flies were anesthetized, followed by grinding in 1 ml methanol with IS1 after freezing by liquid nitrogen. The lysate was then mixed with 1 ml chloroform and 400 μl water by 20 s of vortexing. After centrifugation at 15,000 g for 15 min at 4 °C, 450 μl of aqueous phase was collected and was then filtrated through a 5-kDa cut-off filter (OD003C34, PALL) by centrifuging at 12,000g for 3 h at 4 °C. In parallel, quality control samples were prepared by combining 10 μl of the aqueous phase from each sample and then filtered alongside the samples. The filtered aqueous phase was then freeze-dried in a vacuum concentrator at 4 °C and then dissolved in 100 μl water containing IS2 (50 µM 3-aminopyrrolidine dihydrochloride, 50 µM N,N-diethyl-2-phenylacetamide, 50 µM trimesic acid, 50 µM 2-naphtol-3,6-disulfonic acid disodium salt, dissolved in methanol; used to adjust the migration time). A total of 20 μl of re-dissolved solution was then loaded into an injection vial (9301-0978, Agilent; equipped with a snap cap (5042-6491, Agilent)). Before CE–MS analysis, the fused-silica capillary (TSP050375, i.d. 50 µm × 80 cm; Polymicro Technologies) was installed in a CE–MS cassette (G1603A, Agilent) on a CE system (Agilent Technologies 7100). The capillary was then pre-conditioned with conditioning buffer (25 mM ammonium acetate and 75 mM diammonium hydrogen phosphate, pH 8.5) for 30 min, followed by balancing with running buffer (50 mM ammonium acetate, pH 8.5; freshly prepared) for another 1 h. CE–MS analysis was run in anion mode, during which the capillary was washed with conditioning buffer, followed by injection of the samples at a pressure of 50 mbar for 25 s, and then separation with a constant voltage at −30 kV for another 40 min. Sheath Liquid (0.1 μM hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine, 10 μM ammonium trifluoroacetate, dissolved in methanol and water (50% v/v); freshly prepared) was flowed at 1 ml min^–1 through a 1:100 flow splitter (Agilent Technologies 1260 Infinity II; actual flow rate to the MS: 10 μl min^–1) throughout each run. The parameters of MS (Agilent Technologies 6545) were set as follows: ion source, dual AJS ESI; polarity, negative; nozzle voltage, 2,000 V; fragmentor voltage, 110 V; skimmer voltage, 50 V; OCT RFV, 500 V; drying gas (N₂) flow rate, 7 l min^–1; drying gas (N₂) temperature, 300 °C; nebulizer gas pressure, 8 psig; sheath gas temperature, 125 °C; sheath gas (N₂) flow rate, 4 l min^–1; capillary voltage (applied onto the sprayer), 3,500 V; reference (lock) masses, m/z of 1,033.988109 for hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine and m/z of 112.985587 for trifluoroacetic acid; scanning range: 50–1,100 m/z; and scanning rate, 1.5 spectra per s. Data were collected using MassHunter LC/MS acquisition (v.10.1.48; Agilent Technologies) and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP, ADP, ATP and NAD⁺ were measured using full scan mode with m/z values of 346.0558, 426.0221, 505.9885 and 662.1019, respectively. Note that a portion of ADP and ATP could lose one phosphate group during in-source fragmentation, thus leaving the same m/z ratios as AMP and ADP, and were corrected according to their different retention times in the capillary. Therefore, the total amount of ADP is the sum of the latter peak of the m/z 346.0558 spectrogram and the former peak of the m/z 426.0221 spectrogram, and the same was applied for ATP. Note that the retention time of each metabolite could vary between each run, which was adjusted by using isotope-labelled standards (dissolved in individual cell or tissue lysates) run between each sample, as do IS1 and IS2.

Levels of ATP, ADP, AMP and NAD⁺ in nematodes were analysed using high-performance liquid chromatography (HPLC)–MS as previously described⁷⁸. In brief, 150 nematodes maintained on NGM (with or without LCA) for 2 days were washed with ice-cold M9 buffer containing Triton X-100, followed by removal of bacteria by quickly centrifuging the slurry at 100g for 5 s and then instantly lysing in 1 ml methanol. The lysates were then mixed with 1 ml chloroform and 400 µl water (containing 4 µg ml^–1 [U-¹³C]-glutamine), followed by 20 s of vortexing. After centrifugation at 15,000g for another 15 min at 4 °C, 800 µl of aqueous phase was collected, lyophilized in a vacuum concentrator at 4 °C and then dissolved in 30 µl of 50% (v/v, in water) acetonitrile. Next, 30 µl of supernatant was loaded into an injection vial (5182-0714, Agilent Technologies; with an insert (HM-1270, Zhejiang Hamag Technology)) equipped with a snap cap (HM-2076, Zhejiang Hamag Technology). Measurements of adenylate and NAD⁺ levels were based on ref. ¹²⁵ using a QTRAP MS (QTRAP 5500, SCIEX) interfaced with a UPLC system (ExionLC AD, SCIEX). A total of 2 µl of each sample was loaded onto a HILIC column (ZIC-pHILIC, 5 μm, 2.1 × 100 mm, PN: 1.50462.0001, Millipore). The mobile phase consisted of 15 mM ammonium acetate containing 3 ml l^–1 ammonium hydroxide (>28%, v/v) in LC–MS grade water (mobile phase A) and LC–MS grade 90% (v/v) acetonitrile in LC–MS grade water (mobile phase B) run at a flow rate of 0.2 ml min^–1. Metabolites were separated with the following HPLC gradient elution program: 95% B held for 2 min, then to 45% B in 13 min, held for 3 min, and then back to 95% B for 4 min. The MS was run on a Turbo V ion source in negative mode with a spray voltage of –4,500 V, source temperature of 550 °C, gas no.1 at 50 psi, gas no.2 at 55 psi, and curtain gas at 40 psi. Metabolites were measured using the multiple reactions monitoring mode, and declustering potentials and collision energies were optimized using analytical standards. The following transitions were used for monitoring each compound: 505.9/158.9 and 505.9/408.0 for ATP; 425.9/133.9, 425.9/158.8 and 425.9/328.0 for ADP; 345.9/79.9, 345.9/96.9 and 345.9/133.9 for AMP, 662.0/540.1 for NAD⁺; and 149.9/114 for [U-¹³C]-glutamine. Data were collected using Analyst software (v.1.7.1, SCIEX), and the relative amounts of metabolites were analysed using MultiQuant software (v.3.0.3, SCIEX). Similar to CE–MS analysis, a portion of ADP and ATP could lose one or two phosphate groups during in-source-fragmentation, thus leaving the same m/z ratios as AMP and ADP, which was corrected according to their different retention times in the column.

Reagents

Rabbit polyclonal antibody against V1E1(K99)ac (1:1,000 dilution for IB) was raised using the peptide CARDDLITDLLNEA(AcK) of human V1E1 conjugated to the KLH immunogen (linked to the cysteine residue). A rabbit was then biweekly immunized with 300 µg KLH-conjugated antigen, which was pre-incubated with 1.5 mg manganese adjuvant (provided by Z. Jiang¹²⁶) for 5 min and then mixed with PBS to a total volume of 1.5 ml for 4 times followed by collection of antiserum. The V1E1(K99)ac antibody was then purified from the antiserum using a CARDDLITDLLNEA(AcK) peptide-conjugated SulfoLink Coupling resin/column supplied in a SulfoLink Immobilization kit. To prepare the column, 1 mg of the peptide was first dissolved with 2 ml coupling buffer followed by the addition of 0.1 ml TCEP (25 mM stock concentration) and then incubation at room temperature for 30 min. The mixture was then incubated with SulfoLink Resin in a column, which was pre-calibrated with 2 ml coupling buffer 2 times on a rotator at room temperature for 15 min, followed by incubating at room temperature for 30 min without rotating. The excess peptide was then removed, and the resin was washed with 2 ml of wash solution 3 times, followed by 2 ml coupling buffer 2 times. The nonspecific-binding sites on the resin were then blocked by incubating with 2 ml cysteine solution (by dissolving 15.8 mg of l-cysteine-HCl in 2 ml coupling buffer to make a concentration of 50 mM cysteine) on a rotator for 15 min at room temperature, followed by incubating for another 30 min without rotating at room temperature. After removing the cysteine solution, the resin was washed with 6 ml binding/wash buffer, followed by incubating with 2 ml of antiserum mixed with 0.2 ml of binding/wash buffer for 2 h on a rotator. The resin was then washed with 1 ml of binding/wash buffer 5 times, and the antibody was eluted with 2 ml elution buffer. The eluent was then mixed with 100 μl neutralization buffer. The antibody against basal V1E1 that exists in the crude antibody eluent was then removed through a previously described membrane-based affinity purification method¹²⁷. In brief, the bacterially purified, His-tagged V1E1 was subjected to SDS–PAGE, followed by transferring to a PVDF membrane (see details in the section “Immunoprecipitation and IB assays”). The V1E1-bound-membrane was incubated in 5% (w/v) nonfat milk dissolved in TBST (40 mM Tris, 275 μM NaCl and 0.2% (v/v) Tween-20, pH 7.6) for 2 h, then incubated with the crude antibody preparation for 2 days, and the process was repeated for another 2 times.

The following antibodies were purchased from Cell Signaling Technology: rabbit anti-phospho-AMPKα-Thr172 (2535, RRID: AB_331250; 1:1,000 for IB); anti-AMPKα (2532, RRID: AB_330331; 1:1,000 for IB); anti-phospho-ACC-Ser79 (3661, RRID: AB_330337; 1:1,000 for IB); anti-ACC (3662, RRID: AB_2219400; 1:1,000 for IB); anti-LKB1 (3047, RRID: AB_2198327; 1:1,000 for IB); anti-His-tag (12698, RRID: AB_2744546; 1:1,000 for IB); anti-Myc-tag (2278, RRID: AB_490778; 1:120 for immunofluorescence (IF)); anti-AXIN1 (2074, RRID: AB_2062419; 1:1,000 for IB); anti-SIRT1 (9475, RRID: AB_2617130; 1:1,000 for IB and 1:100 for IF); anti-SIRT2 (12650, RRID: AB_2716762; 1:1,000 for IB); anti-SIRT3 (5490, RRID: AB_10828246; 1:1,000 for IB); anti-SIRT5 (8782, RRID: AB_2716763; 1:1,000 for IB); anti-SIRT6 (12486, RRID: AB_2636969; 1:1,000 for IB); anti-SIRT7 (5360, RRID: AB_2716764; 1:1,000 for IB); anti-histone H3 (4499, RRID: AB_10544537; 1:1,000 for IB); anti-acetyl-histone H3-Lys9 (9649, RRID: AB_823528; 1:1,000 for IB); anti-LAMTOR1 (8975, RRID: AB_10860252; 1:1,000 for IB); anti-GAPDH (5174; RRID: AB_10622025; 1:1,000 for IB); mouse anti-Myc-tag (2276, RRID: AB_331783; 1:120 for IF); and HRP-conjugated mouse anti-rabbit IgG (conformation-specific, 5127, RRID: AB_10892860; 1:2,000 for IB); and anti-ubiquitin (Ub; 3936, RRID: AB_331292; 1:1,000 for IB). The following antibodies were purchased from Santa Cruz Biotechnology: mouse anti-HA-tag (sc-7392, RRID: AB_2894930; 1:500 for IP or 1:120 for IF); anti-LKB1 (sc-32245, RRID: AB_627890, 1:100 for IF); goat anti-AXIN (sc-8567, RRID: AB_22277891; 1:100 for IP (immunoprecipitation) and 1:120 for IF); rabbit anti-VDR (sc-13133, RRID: AB_628040, 1:1,000 for IB); and mouse anti-goat IgG-HRP (sc-2354, RRID: AB_628490; 1:2,000 for IB). The following antibodies were purchased from Abcam: mouse anti-total OXPHOS (ab110413, RRID: AB_2629281; 1:5,000 for IB); rat anti-LAMP2 (ab13524, RRID: AB_2134736; 1:120 for IF); rabbit anti-laminin (ab11575, RRID: AB_298179; 1:200 for IF); anti-phospho-AMPKα2-Ser345 (ab129081, 1:1,000 for IB); anti-transferrin (ab1223, RRID: AB_298951; 1:500 for IB); anti-ATP6V1B2 (ab73404, RRID: AB_1924799; 1:1,000 for IB); anti-PEN2 (ab154830, 1:1,000 for IB); and goat anti-SIRT4 (ab10140, RRID: AB_2188769; 1:1,000 for IB). The following antibodies were purchased from Developmental Studies Hybridoma Bank: mouse anti-eMHC (BF-G6, RRID: AB_10571455; 1:100 for IHC); anti-Pax7 (Pax-7, RRID: AB_2299243; 1:100 for IHC); anti-MHCIIa (SC71, RRID: AB_2147165; 1:100 for IHC); anti-MHCIIb (BF-F3, RRID: AB_2266724; 1:100 for IHC); and anti-MHCI (C6B12, RRID: AB_528351; 1:100 for IHC). The following antibodies were purchased from Proteintech: rabbit anti-tubulin (10068-1-AP, RRID: AB_2303998; 1:1,000 for IB nematode tubulin); anti-ATP6V1E1 (15280-1-AP, RRID: AB_2062545; 1:1,000 for IB); anti-TULP3 (13637-1-AP, RRID: AB_2211547, 1:20,000 for IB); anti-TOMM20 (11802-1-AP, RRID: AB_2207530; 1:1,000 for IB); anti-YES 20243-1-AP, RRID: AB_10697656; 1:1,000 for IB); mouse anti-tubulin (66031-1-Ig, RRID: AB_11042766; 1:20,000 for IB mammalian tubulin); and anti-HA-tag (66006-2-Ig, RRID: AB_2881490; 1:20,000 for IB). Rabbit anti-ATP6v0c (NBP1-59654, RRID: AB_11004830; 1:1,000 for IB) was purchased from Novus Biologicals. Mouse anti β-actin (A5316, RRID: AB_476743; 1:1,000 for IB) and anti-Flag M2 affinity gel (A2220, 1:500 for IP) were purchased from Sigma. The following antibodies were purchased from Thermo: donkey anti-goat IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 488 (A-32814, RRID: AB_2762838; 1:100 for IF); donkey anti-rat IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor 594 (A-21209, RRID: AB_2535795; 1:100 for IF); goat anti-mouse IgM (heavy chain) cross-adsorbed secondary antibody, Alexa Fluor 488 (A-21042, RRID: AB_2535711; 1:200 for IHC); goat anti-mouse IgG2b cross-adsorbed secondary antibody, Alexa Fluor 594 (A-21145, RRID: AB_2535781; 1:200 for IHC); goat anti-mouse IgG1 cross-adsorbed secondary antibody, Alexa Fluor 647 (A-21240, RRID: AB_2535809; 1:200 for IHC); goat anti-mouse IgG1 cross-adsorbed secondary antibody, Alexa Fluor 488 A-21121, RRID: AB_2535764; 1:200 for IHC); goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor 488 (A11034, RRID: AB_2576217; 1:200 for IF); and goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 (A-11012, RRID: AB_2534079; 1:200 for IHC). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (115-035-003, RRID: AB_10015289; 1:5,000 dilution for IB) and goat anti-rabbit IgG (111-035-003, RRID: AB_2313567; 1:5,000 dilution for IB) were purchased from Jackson ImmunoResearch.

The following reagents were purchased from Sigma (catalogue numbers in parentheses): DMSO (D2650), LCA (L6250), (2-hydroxypropyl)-β-cyclodextrin (C0926), methanol (646377), ethanol (459836), chloroform (C7559), PBS (P5493), Triton X-100 (T9284), sodium acetate (NaAc; S5636), nuclease-free water (W4502), human tubal fluid (HTF) medium (MR-070-D), KSOM medium (MR-121-D), L-glutathione reduced (GSH; G4251), NaCl (S7653), CaCl₂ (C5670), MgSO₄ (M2643), KH₂PO₄ (P5655), K₂HPO₄ (P9666), streptomycin (85886), cholesterol (C3045), agar (A1296), propionic acid (P5561), sucrose (S7903), glucose (G7021), 2-methylbutane (isopentane; M32631), paraformaldehyde (158127), Canada balsam (C1795), BSA (A2153), glycerol (G5516), Na₂HPO₄ (S7907), sodium hypochlorite solution (NaClO; 239305), NaOH (S8045), Iron(II) sulfate heptahydrate (FeSO₄; F8633), HEPES (H4034), EDTA (E6758), EGTA (E3889), MgCl₂ (M8266), KCl (P9333), IGEPAL CA-630 (NP-40; I3021), dithiothreitol (DTT; 43815), IPTG (I6758), carbenicillin (C1613), d-mannitol (M4125), glycine (G8898), isopropanol (34863), diethylpyrocarbonate (DEPC)-treated water (693520), trioxsalen (TMP; T6137), methyl 4-hydroxybenzoate (methyl paraben; H3647), mineral oil (M5310), halocarbon oil 700 (H8898), halocarbon oil 27 (H8773), paraquat (36541), H₂O₂ (H1009), agarose (A9539), proteinase K (P6556), l-methionine sulfone (M0876), d-campher-10-sulfonic acid (1087520), acetonitrile (34888), ammonium acetate (73594), ammonium hydroxide solution (338818), 3-aminopyrrolidine dihydrochloride (404624), N,N-diethyl-2-phenylacetamide (384011), trimesic acid (482749), diammonium hydrogen phosphate (1012070500), ammonium trifluoroacetate (56865), formic acid (5.43804), diammonium hydrogen phosphate (1012070500), ammonium trifluoroacetate (56865), Tween-20 (P9416), hexadimethrine bromide (polybrene; H9268), octyl β-d-glucopyranoside (ODG; O8001), Trizma base (Tris; T1503), sodium pyrophosphate (P8135), β-glycerophosphate (50020), SDS (436143), sodium deoxycholate (S1827), β-mercaptoethanol (M6250), formaldehyde solution (formalin; F8775), chloroform-d (with 0.05% (v/v) tetramethylsilane (TMS); 612200), N,N-dimethylformamide (DMF; 33120), N,N-diisopropylethylamine (DIEA; 199818), dichloromethane (DCM; 650463), Na₂SO₄ (746363), NaHCO₃ (S5761), ATP (A7699), IPTG (I6758), imidazole (I5513), HIS-select nickel affinity gel (P6611), Coomassie Brilliant Blue R-250 (1.12553), acetic acid (27225), TCEP (C4706), TBTA (678937), CuSO₄ (C1297), trichloroacetic acid (91228), ammonium formate (70221), FCCP (C2920), sodium azide (NaN₃; S2002), gentamycin (345814), collagenase A (11088793001), oligomycin A (75351), concanamycin A (conA; C9705), fluorescein isothiocyanate–dextran (FITC-dextran; FD10S), lysosome isolation kit (LYSISO1) and Duolink In Situ Red Starter kit (Mouse/Rabbit; DUO92101). The following reagents were purchased from Thermo: TRIzol (15596018), Phusion High-Fidelity DNA Polymerase kit (F530N), mMESSAGE mMACHINE T7 Transcription kit (AM1344), MEGAclear Transcription Clean-Up kit (AM1908), MEGAshortscript T7 Transcription kit (AM1354), Maxima SYBR Green/ROX qPCR master mix (K0223), SulfoLink Immobilization kit for Peptides (44999), DMEM, high glucose (DMEM; 12800082), FBS (10099141C), penicillin–streptomycin (15140163), Lipofectamine 2000 (11668500), MEM non-essential amino acids solution (11140050), GlutaMAX (35050061), sodium pyruvate (11360070), ProLong Diamond antifade mountant (P36970), ProLong Live Antifade reagent (P36975), streptavidin magnetic beads (88817; 1:100 for IP), prestained protein MW marker (26612), and LysoSensor Green DND-189 (L7535). MinElute PCR Purification kit (28004) was purchased from Qiagen. EX-527 (S1541) and MG-132 (S2619) were purchased from Selleck. Biospin Tissue Genomic DNA Extraction kit (BSC04M1) was purchased from BioFlux. hCG (110900282) and PMSG (110904564) were purchased from Sansheng Biological Technologyk. WesternBright ECL and peroxide solutions (210414-73) were purchased from Advansta. Bacteriological peptone (LP0037) and yeast extract (LP0021) were purchased from Oxoid. Protease inhibitor cocktail (70221) was purchased from Roche. 3-Hydroxynaphthalene-2,7-disulfonic acid disodium salt (2-naphtol-3,6-disulfonic acid disodium salt; H949580) was purchased from Toronto Research Chemicals. Hexakis(1H,1H,3H-perfluoropropoxy)phosphazene (hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine; sc-263379) was purchased from Santa Cruz Biotechnology. Polyethylenimine (PEI; 23966) was purchased from Polysciences. Nonfat dry milk (9999) and normal goat serum (NGS; 5425) were purchased from Cell Signaling Technology. 2-(3-(but-3-yn-1-yl)-3H-diazirin-3-yl)Ethan-1-amine and 1H-benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP) were purchased from Bidepharm. OCT compound (4583) was purchased from Sakura. ReverTra Ace qPCR RT master mix with gDNA remover (FSQ-301) was purchased from Toyobo. PrimeSTAR HS polymerase (R40A) was purchased from Takara. Dry yeast (FLY804020F) and cornmeal (FLY801020) were purchased from LabScientific. Soy flour (62116) was purchased from Genesee Scientific. Light corn syrup was purchased from Karo. Grape juice was purchased from Welch’s. Cell Counting Kit-8 (CCK-8) was purchased from ApexBio. [U-¹³C]-glutamine (184161-19-1) was purchased from Cambridge Isotope Laboratories. rProtein A Sepharose Fast Flow (17127904), Protein G Sepharose 4 Fast Flow (17061806) and Superdex 200 Increase 10/300 GL (28990944) were purchased from Cytiva.

Cell lines

In this study, no cell lines used are on the list of known misidentified cell lines maintained by the International Cell Line Authentication Committee (https://iclac.org/databases/cross-contaminations/). HEK293T cells (CRL-3216) were purchased from the American Type Culture Collection. LAMTOR1^F/F, AXIN^F/F and PKCZ^F/F MEFs were established by introducing SV40 T antigen using lentivirus into cultured primary embryonic cells from mouse litters. LAMTOR1^–/– MEFs were generated by infecting LAMTOR1^F/F MEFs with adenoviruses expressing the Cre recombinase for 12 h, as for AXIN^–/– MEFs and PKCZ^–/– MEFs. The infected cells were then incubated in fresh DMEM for another 12 h before further treatments. The ALDO-TKD¹⁰, TRPV-QKO¹², PEN2^–/– (ref. ¹⁵), ATP6AP1^–/– (ref. ¹⁵) and AMPKA1/2^–/– (ref. ¹²⁸) MEFs, and siATP6V0C¹¹ HEK293T cells were generated and validated as previously described. HEK293T cells and MEFs were maintained in DMEM supplemented with 10% FBS, 100 IU penicillin and 100 mg ml^–1 streptomycin at 37 °C in a humidified incubator containing 5% CO₂. All cell lines were verified to be free from mycoplasma contamination. HEK293T cells and MEFs were authenticated by STR sequencing performed by Immocell Biotechnology. PEI at a final concentration of 10 μM was used to transfect HEK293T cells (ectopic expression). Total DNA to be transfected for each plate was adjusted to the same amount by using relevant empty vector. Transfected cells were collected at 24 h after transfection.

Lentiviruses, including those for knockdown or stable expression (expressed at close-to-endogenous levels), were packaged in HEK293T cells by transfection using Lipofectamine 2000. At 30 h after transfection, medium (DMEM supplemented with 10% FBS and MEM non-essential amino acids; approximately 2 ml) was collected and centrifuged at 5,000g for 3 min at room temperature. The supernatant was mixed with 10 μg ml^–1 polybrene and was added to MEFs or HEK293T cells, followed by centrifuging at 3,000g for 30 min at room temperature (spinfection). Cells were incubated for another 24 h (MEFs) or 12 h (HEK293T cells) before further treatments. The sequence of each siRNA used to knockdown mouse Tulp3 is: 5′-GCATCTTGAGTAGTGTGAACTATGA-3′ (1), 5′-CCAGCTTGGAGAAGTGGAGAATTTA-3′ (2), and 5′-GAGAATTTAGAGGACTTTGCGTATA-3′ (3).

Genes encoding SIRT1–SIRT7, FXR, FXRβ, PXR, VDR, CAR, LXRα, LXRβ, S1PR2, CHRM2, CHRM3, FAS, FPR1, YES1 and TULP3 were deleted from MEFs using the CRISPR–Cas9 system. Nucleotides were annealed to their complements containing the cloning tag aaac and inserted into the back-to-back BsmB I restriction sites of the lentiCRISPRv2 vector. The sequence for each sgRNA is as follows: 5′-CGGTATCTATGCTCGCCTTG-3′ and 5′-CAAGGCGAGCATAGATACCG-3′ for Sirt1, 5′-AAGGACGGGGAACTTACACG-3′ and 5′-CGTGTAAGTTCCCCGTCCTT-3′ for Sirt2, 5′-AACATCGACGGGCTTGAGAG-3′ and 5′-CTCTCAAGCCCGTCGATGTT-3′ for Sirt3, 5′-GGCGGCACAAATAACCCCGA-3′ and 5′-TCGGGGTTATTTGTGCCGCC-3′ for Sirt4, 5′-CATTGACGAGTTGCATCGCA-3′ and 5′-TGCGATGCAACTCGTCAATG-3′ for Sirt5, 5′-CGAGGGCCGAGCATTCTCGA-3′ and 5′-TCGAGAATGCTCGGCCCTCG-3′ for Sirt6, 5′-CCGACTTCGACCCTGCAGCT-3′ and 5′-AGCTGCAGGGTCGAAGTCGG-3′ for Sirt7, 5′-ACCAGTCTTCCGGTTGTTGG-3′ and 5′-CCAACAACCGGAAGACTGGT-3′ for Fxr (1), 5′-CGAATGGCCGCGGCATCGGC-3′ and 5′-GCCGATGCCGCGGCCATTCGC-3′ for Fxr (2), 5′-ACCAGTCTTCCGGTTGTTGG-3′ and 5′-CCAACAACCGGAAGACTGGT-3′ for Fxrb (1), 5′-GGACTCGACGCTCGAGAATC-3′ and 5′-GATTCTCGAGCGTCGAGTCC-3′ for Fxrb (2), 5′-TGAAACGCAATGTCCGGCTG-3′ and 5′-CAGCCGGACATTGCGTTTCA-3′ for Pxr (1), 5′-GATCATGTCCGATGCCGCTG-3′ and 5′-CAGCGGCATCGGACATGATC-3′ for Pxr (2), 5′-ACTTTGACCGGAATGTGCCT-3′ and 5′-AGGCACATTCCGGTCAAAGT-3′ for Vdr (1), 5′-TGGAGATTGCCGCATCACCA-3′ and 5′-TGGTGATGCGGCAATCTCCA-3′ for Vdr (2), 5′-CGGCCCATATTCTTCTTCAC-3′ and 5′-GTGAAGAAGAATATGGGCCG-3′ for Car (1), 5′-GGGGCCCACACTCGCCATGT-3′ and 5′-ACATGGCGAGTGTGGGCCCC-3′ for Car (2), 5′-TTCCGCCGCAGTGTCATCAA-3′ and 5′- TTGATGACACTGCGGCGGAA -3′ for Lxra, 5′-GCCGGGCGCTATGCCTGTCG-3′ and 5′-CGACAGGCATAGCGCCCGGC-3′ for Lxrb (1), 5′-CATAGCGCCCGGCCCCACCG-3′ and 5′-CGGTGGGGCCGGGCGCTATG-3′ for Lxrb (2), 5′-CGTGCAGTGGTTTGCCCGAG-3′ and 5′-CTCGGGCAAACCACTGCACG-3′ for S1pr2 (1), 5′-AAGACGGTCACCATCGTACT-3′ and 5′-AGTACGATGGTGACCGTCTT-3′ for S1pr2 (2), 5′-GCATGATGATTGCAGCTGCG-3′ and 5′-CGCAGCTGCAATCATCATGC-3′ for Chrm2, 5′-GCCGTGCCGAAGGTGATGGT-3′ and 5′-ACCATCACCTTCGGCACGGC-3′ for Chrm3 (1), 5′-AGCCGGTGTGATGATTGGTC-3′ and 5′-GACCAATCATCACACCGGCT-3′ for Chrm3 (2), 5′-TCTCCGAGAGTTTAAAGCTG-3′ and 5′-CAGCTTTAAACTCTCGGAGA-3′ for Fas (1), 5′-TGCTCAGAAGGATTATATCA-3′ and 5′-TGATATAATCCTTCTGAGCA-3′ for Fas (2), 5′-AGAAGGTAATCATCGTACCC-3′ and 5′-GGGTACGATGATTACCTTCT-3′ for Fpr1 (1), 5′-GGGCAACGGGCTCGTGATCT-3′ and 5′-AGATCACGAGCCCGTTGCCC-3′ for Fpr1 (2), 5′-TCTAGTCGCAATGATTCTCG-3′ and 5′-CGAGAATCATTGCGACTAGA-3′ for Yes1, 5′-CTCCCCGTCGGCTCGCTCAG-3′ and 5′-CTGAGCGAGCCGACGGGGAG-3′ for Tulp3 (1), 5′-ACGTCGCTGCGAGGCATCTG-3′ and 5′-CAGATGCCTCGCAGCGACGT-3′ for Tulp3 (2). The constructs were then subjected to lentivirus packaging using HEK293T cells that were transfected with 2 µg of DNA in Lipofectamine 2000 transfection reagent per well of a 6-well plate. At 30 h after transfection, the virus (approximately 2 ml) was collected for infecting MEFs as described above, except cells cultured to 15% confluence were incubated with the virus for 72 h. When cells were approaching to confluence, they were single-cell sorted into 96-well dishes. Clones were expanded and evaluated for knockout status by sequencing.

To knock in the HA-tag in front of the first exon of Sirt3, Sirt4 and Sirt5 in MEFs, the 3×HA sequence (insert) flanked by 150-bp 5′ and 3′ sequences of Sirt3, Sirt4 or Sirt5 (5′ and 3′ homology arms), was synthesized and cloned into a pBluescript II KS (+) vector as a template. MEFs grown in a 10-cm dish to 80% confluence were trypsinized and resuspended with 2 ml DMEM, followed by determining the cell density using a CountStar (IC 1000) cell counter equipped with a chamber slide (12-0005-50). About 10⁶ cells were then suspended with 400 µl of electroporation buffer (freshly prepared by mixing 80 µl of solution A (362.88 mM ATP and 590.26 mM MgCl₂ in di-distilled water, sterilized by passing through a 0.22-μm filter) with 4 ml of solution B (88.18 mM KH₂PO₄, 14.284 mM NaHCO₃ and 2.2 mM glucose, pH 7.4 in di-distilled water, sterilized by passing through a 0.22-μm filter)) in a Gene Pulser/MicroPulser electroporation cuvette (0.4-cm gap; 1652088, Bio-Rad), followed by mixing with 2 μg of Cas9 mRNA (synthesized as previously described¹²⁹ and dissolved with DEPC water to a 1.5 μg μl^–1 stock solution), 2 μg of sgRNA (synthesized and chemically modified by the EasyEdit sgRNA synthetic service provided by GenScript, dissolved with DEPC water to a 1 μg μl^–1 stock solution) and 6 μg of the template. Cells were then electroporated on a Nucleofector II (Lonza) electroporator using the T-020 programme, followed by incubating in 2 ml DMEM in a 6-well dish at 37 °C in a humidified incubator containing 5% CO₂ for 30 min. The presence of the HA-tag was validated by sequencing. The sequence for each sgRNA is as follows: 5′-CATGACCACCACCCTACTGC-3′ for Sirt3, 5′-ATTGACTTTCAGGCCGACAA-3′ for Sirt4, and 5′-CAATCAGGAGAGGTCGCATC-3′ for Sirt5.

Plasmids

Full-length cDNAs used in this study were obtained either by PCR using cDNA from MEFs or by purchasing from Origene or Sino Biological. The DN mutants of SIRT1–SIRT7, that is, SIRT1(H363Y)¹³⁰, SIRT2(H150Y)¹³¹, SIRT3(H248Y)⁶⁵, SIRT4(H161Y)¹³², SIRT5(H158Y)¹³³, SIRT6(H133Y)²⁹ and SIRT7(H187Y)⁷⁰, were generated according to previous reports. Mutations of V1E1, SIRT1–SIRT7 and TULP3 were performed by PCR-based site-directed mutagenesis using PrimeSTAR HS polymerase. Expression plasmids for various epitope-tagged proteins were constructed in a pcDNA3.3 vector (K830001, Thermo) for transfection (ectopic expression) in mammalian cells, in a pBOBI vector for lentivirus packaging (stable expression) in mammalian cells, in a in pLVX-IRES (for ALDOA; 631849, Takara) for doxycycline-inducible expression in mammalian cells, or in a pET-28a vector (69864-3, Novagen) for bacterial expression. PCR products were verified by sequencing (Invitrogen). All expression plasmids constructed in this study have been deposited into Addgene (https://www.addgene.org/Sheng-cai_Lin/). The lentivirus-based vector pLV-H1-EF1a-puro (SORT-B19, Biosettia) was used for the expression of siRNA in MEFs. E. coli strain DH5α (PTA-1977) was purchased from the American Type Culture Collection, and Stbl3 (C737303) was from Thermo. All plasmids were amplified in E. coli strain DH5α, except those for mutagenesis in Stbl3. All plasmids used in this study were purified by using CsCl density gradient ultracentrifugation method.

Immunoprecipitation and IB assays

For determining the formation of the AMPK-activating complex, endogenous AXIN was immunoprecipitated and analysed as previously described¹¹. In brief, four 15-cm dishes of MEFs (grown to 80% confluence) were collected for immunoprecipitation of AXIN. Cells were lysed with 750 μl per dish of ice-cold ODG buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM EDTA, 2% (w/v) ODG, 5 mM β-mercaptoethanol with protease inhibitor cocktail), followed by sonication and centrifugation at 4 °C for 15 min. Cell lysates were incubated with anti-AXIN antibody overnight. Overnight protein aggregates were pre-cleared by centrifugation at 20,000 g for 10 min, and protein A/G beads (1:250, balanced with ODG buffer) were then added into the lysate–antibody mixture for another 3 h at 4 °C. The beads were centrifuged and washed with 100 times the volume of ODG buffer 3 times (by centrifuging at 2,000g) at 4 °C and then mixed with an equal volume of 2× SDS sample buffer and boiled for 10 min before IB.

To determine the interaction between ectopically expressed TULP3 and sirtuins, a 6 cm-dish of HEK293T cells was transfected with different expression plasmids. At 24 h after transfection, cells were collected and lysed in 500 µl of ice-cold Triton lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% (v/v) Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, with protease inhibitor cocktail), followed by sonication and centrifugation at 4 °C for 15 min. Anti-HA-tag (1:100) or anti-MYC-tag (1:100) antibodies, along with protein A/G beads (1:100, pre-balanced in Triton lysis buffer) were added into the supernatant and mixed for 4 h at 4 °C. The beads were washed with 200 times the volume of ice-cold Triton lysis buffer wash buffer 3 times at 4 °C and then mixed with an equal volume of 2× SDS sample buffer and boiled for 10 min before IB.

The ubiquitination of V1E1 was determined as previously described¹³⁴. In brief, a 6 cm-dish of HEK293T cells were transfected with 6 µg HA-tagged V1E1 and 6 µg Flag-tagged ubiquitin. At 12 h after transfection, cells were treated with 20 nM MG-132 for another 12 h. The culture medium was then aspirated, and the cells were lysed by quick addition of 500 µl of RIPA buffer containing 1% SDS (25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% (v/v) NP-40, 1% (w/v) sodium deoxycholate, 1% (w/v) SDS) into the dish, followed by boiling in water for 15 min. The lysates were then diluted with 9-fold volumes of RIPA buffer without SDS, and 500 µl of the diluent was used for immunoprecipitation of HA-tag as described above. The levels of V1E1 ubiquitination were then determined by IB.

To analyse the levels of pAMPKα, pACC and V1E1(K99)ac in HEK293T cells and MEFs, cells grown to 70–80% confluence in a well of a 6-well dish were lysed with 250 μl of ice-cold Triton lysis buffer. The lysates were then centrifuged at 20,000g for 10 min at 4 °C and an equal volume of 2× SDS sample buffer was added to the supernatant. Samples were then boiled for 10 min and then directly subjected to IB. To analyse the levels of pAMPKα, pACC and V1E1(K99)ac in muscle and liver tissues, mice were anaesthetized after indicated treatments. Freeze-clamped tissues were immediately lysed with ice-cold Triton lysis buffer (10 μl mg^–1 tissue weight for liver, and 5 μl mg^–1 tissue weight for muscle), followed by homogenization and centrifugation as described above. The lysates were then mixed with 2× SDS sample buffer, boiled and subjected to IB. To analyse the levels of p-AMPKα and pACC in flies, 20 adults or third instar larvae were lysed with 200 μl ice-cold RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, with protease inhibitor cocktail) containing 0.1% SDS, followed by homogenization and centrifugation as described above. The lysates were then mixed with 5× SDS sample buffer, boiled and subjected to IB. To analyse the levels of pAMPKα and pACC in nematodes, 150 nematodes cultured on NGM plates were collected for each sample. Worms were quickly washed with ice-cold M9 buffer containing Triton X-100 and were lysed with 150 μl of ice-cold lysis buffer. The lysates were then mixed with 5× SDS sample buffer, followed by homogenization and centrifugation as described above and then boiled before being subjected to IB.

All samples were subjected to IB on the same day of preparation, and any freeze–thaw cycles were avoided.

For IB, the SDS–PAGE were prepared in house, as previously described¹⁵. The thickness of the gels used in this study was 1.0 mm. Samples of less than 10 μl were loaded into wells, and electrophoresis was run at 100 V (using a PowerPac HC High-Current Power Supply, Bio-Rad) in a Mini-PROTEAN Tetra Electrophoresis Cell (Bio-Rad). In this study, all samples were resolved on 8% resolving gels, except those for H3, H3K9ac, LAMTOR1, OXPHOS proteins and ATP6V0C, which were on 15% gels (prepared as those for 8%, except that a final concentration of 15% Acryl–Bis was added to the resolving gel solution), and β-actin, GAPDH, ALDOA, V1E1 and V1E1(K99)ac, which were on 10% gels. The resolved proteins were then transferred to the PVDF membrane (0.45 μm, IPVH00010, Merck) as previously described¹⁵. The PVDF membrane was then blocked by 5% (w/v) BSA (for all antibodies against phosphorylated proteins) or 5% (w/v) nonfat milk (for all antibodies against total proteins) dissolved in TBST for 2 h on an orbital shaker at 60 r.p.m. at room temperature, followed by rinsing with TBST for twice, 5 min each. The PVDF membrane was then incubated with the desired primary antibody overnight at 4 °C on an orbital shaker at 60 r.p.m., followed by rinsing with TBST 3 times, 5 min each at room temperature, and then the secondary antibodies for 3 h at room temperature with gentle shaking. The secondary antibody was then removed, and the PVDF membrane was further washed with TBST 3 times, 5 min each, at room temperature. The PVDF membrane was incubated in an ECL mixture (by mixing equal volumes of ECL solution and peroxide solution for 5 min), then life with medical X-ray film (Fujifilm). The films were then developed using X-OMAT MX developer (Carestream), and X-OMAT MX fixer and replenisher solutions (Carestream) on a medical X-ray processor (Carestream) using Developer (Model 002, Carestream). The developed films were scanned using a Perfection V850 Pro scanner (Epson) with Epson Scan software (v.3.9.3.4) and were cropped using Photoshop 2023 software (Adobe). Levels of total proteins and phosphorylated proteins were analysed on separate gels, and representative immunoblots are shown. Uncropped immunoblots are shown in Supplementary Fig. 1. The band intensities on developed films were quantified using ImageJ software (v.1.8.0, National Institutes of Health Freeware) and formatted using Illustrator 2022 (Adobe).

Confocal microscopy

For determining the lysosomal localization of AXIN and LKB1, cells grown to 80% confluence on coverslips in 6-well dishes were fixed for 20 min with 4% (v/v) formaldehyde in PBS at room temperature. The coverslips were rinsed twice with PBS and permeabilized with 0.1% (v/v) Triton X-100 in PBS for 5 min at 4 °C. After rinsing twice with PBS, the sections were blocked with PBS containing 5% BSA for 30 min at room temperature. Then the coverslips were incubated with anti-AXIN or anti-LKB1, and anti-LAMP2 antibodies (all at 1:100, diluted in PBS) overnight at 4 °C. The cells were then rinsed 3 times with 1 ml of PBS and then incubated with secondary antibody for 8 h at room temperature in the dark. Cells were washed another 4 times with 1 ml PBS and then mounted on slides using ProLong Diamond antifade mountant. Confocal microscopy images were taken using a STELLARIS 8 FALCON (Leica) system equipped with HyD SMD detectors and a HC PL APO CS2 ×63/1.40 oil objective (Leica). All parameters were kept unchanged between imaging. Images were taken and analysed using LAS X Software (v.3.0.2.16120, Leica) and formatted using Photoshop 2023 software (Adobe).

The localization of SIRT3, SIRT4 and SIRT5 (HA-tagged) was determined as described above, except that antibodies against HA-tag and TOMM20 were used. For SIRT1, MEFs grown to 80% confluence on coverslips in 6-well dishes were fixed for 20 min with 4% (v/v) formaldehyde in PBS at room temperature. The coverslips were rinsed twice with PBS and permeabilized with 0.5% (v/v) NP-40 in PBS for 15 min at room temperature. After rinsing twice with PBS, the sections were blocked with PBS containing 5% BSA for 30 min at room temperature. The coverslips were then incubated with anti-SIRT1 antibodies (1:100, diluted in PBS) for 8 h at room temperature, followed by rinsing 3 times with 1 ml of PBS. Cells were then incubated with Alexa Fluor 488-conjugated, goat anti-rabbit IgG secondary antibody (1:100, diluted in PBS) for 2 h at room temperature and at 37 °C for another 30 min in the dark. Cells were washed another 4 times with 1 ml PBS and then mounted on slides using the Duolink In Situ mounting medium with DAPI (from a Duolink In Situ Red Starter kit). Confocal microscopy images were taken using a STELLARIS 8 FALCON (Leica) system equipped with HyD SMD detectors and a HC PL APO CS2 63x/1.40 oil objective (Leica). All parameters were kept unchanged between imaging. Images were taken and analysed using LAS X Software (v.3.0.2.16120, Leica) and formatted using Photoshop 2023 software (Adobe).

For detecting the pH of lysosomes, cells were grown on a 4-chamber 35-mm glass-bottom dish (D35C4-20-1.5-N, In Vitro Scientific). Cells were cultured to 60–80% confluence and then treated with LCA or DMSO control in neighbouring chambers in the same 35-mm dish. Cells were treated with 1 μM (final concentration) LysoSensor Green DND-189 (ref. ¹³⁵) for 30 min, then washed twice with PBS and incubated in fresh medium for another 30 min. In the meantime, ProLong Live antifade reagent was added to the medium before taking images. All cells were stained and processed simultaneously. In particular, any counterstaining, such as using Hoechst dye to stain the nucleus, was avoided in this experiment to prevent nonspecific staining. During imaging, live cells were kept at 37 °C, 5% CO₂ in a humidified incubation chamber (Zeiss, Incubator PM S1). All parameters, such as PMT voltage, offset, pinhole and gain were kept unchanged between each picture taken. Images were taken using a Zeiss LSM 980 with a ×63, 1.4 NA oil objective.

The PLA/Duolink assay was performed using a Duolink In Situ Red Starter kit (Mouse/Rabbit) as previously described¹³⁶. In brief, WT MEFs, or HA-tagged SIRT3-knockin (SIRT3-KI), SIRT4-KI or SIRT5-KI MEFs, all stably expressing MYC-tagged TULP3 (or TULP3(Δ1–60)) were grown to 80% confluence on coverslips in 6-well dishes, followed by fixation for 20 min with 4% (v/v) formaldehyde in PBS, 2 ml per coverslip per well at room temperature. The coverslips were rinsed twice with 2 ml PBS and permeabilized with 2 ml of 0.1% (v/v) Triton X-100 in PBS for 10 min at 4 °C. Cells were then blocked with Duolink blocking solution (50 μl per coverslip) in a humidified chamber at 37 °C for 1 h. Cells were then incubated with primary antibodies (1:100 diluted with Duolink antibody diluent; 50 μl per coverslip) in a humidified chamber at 4 °C for 12 h, followed by washing with 2 changes of 2 ml of wash buffer A, 5 min per change, at room temperature. The coverslip was then incubated with Plus and Minus PLA probe solution (freshly prepared by mixing 10 μl of PLA probe Minus stock, 10 μl of PLA probe Plus stock with 30 μl of Duolink antibody diluent; 50 μl per coverslip) in a humidified chamber at 37 °C for 1 h, followed by washing with 2 changes of 2 ml of wash buffer A, 5 min per change, at room temperature. The coverslip was then incubated with ligation solution (freshly prepared by 1:5 diluting Duolink ligation buffer with water, followed by the addition of ligase stock at a ratio of 1:50; 50 μl per coverslip) in a humidified chamber at 37 °C for 0.5 h, followed by washing with 2 changes of 2 ml of wash buffer A, 5 min per change, at room temperature. The coverslip was then incubated with amplification solution (freshly prepared by 1:5 diluting amplification buffer with water, followed by addition of polymerase stock at a ratio of 1:80; 50 μl per coverslip) in a humidified chamber at 37 °C for 100 min, followed by washing with 2 changes of 2 ml of wash buffer B, 10 min per change, at room temperature. The coverslip was then washed with 2 ml of 0.01× wash buffer B for 1 min at room temperature, followed by mounting with 15 μl of Duolink PLA mounting medium with DAPI for 30 min, and then subjected to imaging using an LSM 980 (Zeiss) as described above, except that a DPSS laser module (Lasos) at 594 nm and a diode laser module (Lasos) at 405 nm were used to excite the PLA and DAPI, respectively.

FRET–FLIM assay

FRET-FLIM experiments were carried out as previously described¹³⁶. In brief, HEK293T cells stably expressing TULP3–GFP (‘donor only’, as a control), or different combinations of SIRT1–mCherry and TULP3–GFP, or TULP3(Δ1–60)–GFP as a control, were cultured in 35-mm glass-bottom dishes (D35-20-10-N, In Vitro Scientific) to 60–80% confluence in a humidified chamber with 5% CO₂ at 37 °C, followed by determining the fluorescence lifetime of GFP in different cells using a STELLARIS 8 FALCON (Leica) system equipped with HyD X and HyD SMD detectors and a HC PL APO CS2 ×63/1.40 oil objective (Leica). Cells were excited with a 460-nm laser through the system’s tuneable white light laser, and photon arrival times were recorded using a HyD X detector covering the GFP emission spectrum (460–510 nm). All parameters were kept unchanged between imaging. Images were taken and analysed using LAS X software (v.3.0.2.16120, Leica). In all experiments, the position of the focal plane was actively stabilized using Leica auto focus control to prevent any focal drift or focus artefacts.

Synthesis of the LCA probe

All reagents and solvents were obtained from commercial suppliers and described in the section ‘Reagents’. In this section, the following equipment were used: preparative HPLC (Sail 1000, Welch Materials) equipped with a RD-C18 column (30.0 × 250 mm, 5 μm; Welch Materials) was used for the purification of LCA probe; 3100 Mass Detector (Waters) was used to record MS spectra for each compound; Q-Exactive Orbitrap MS (Thermo) was used to record high-resolution MS spectra for each compound; HPLC with UV detection at 220 nm (HD-C18 column, 5 μm, 4.6 × 250 mm, Agilent Technologies) was used to determine the purity of the LCA probe, and the gradients were as follows: t = 0 min, 20% solvent B (methanol) and 80% solvent A (H₂O); t = 10 min, 100% solvent B (methanol) and 0% solvent A (H₂O); t = 30 min, 100% B (methanol) and 0% solvent A (H₂O) with a constant flow rate at 1 ml min^–1); and Bruker Avance III 600 MHz NMR spectrometer (¹H: 600 MHz; ¹³C: 151 MHz) was used to record NMR spectra (spectrometer instrument in chloroform-d, with TMS as the internal standard; chemical shifts are reported in δ (ppm), multiplicities (s = singlet, d = doublet, t = triplet, q = quartet, p = pentet, dd = doublet of doublets, td = triplet of doublets, tt = triplet of triplets and m = multiplet), integration and coupling constants (J in Hz), and ¹H and ¹³C chemical shifts are relative to the solvent: δ_H of 7.26 and δ_C of 77.2 for chloroform-d).

The biotin-N₃ linker was synthesized as previously described¹³⁷, and the LCA probe was synthesized through an amide condensation reaction between LCA and 2-(3-(but-3-yn-1-yl)-3H-diazirin-3-yl)ethan-1-amine. In brief, LCA (55 mg, 0.146 mmol, 1.0 eq) was dissolved in 2 ml of DMF, followed by mixing with 97.3 mg BOP (0.219 mmol, 1.5 eq). After 30 min of stirring at room temperature, 24 mg of 2-(3-(but-3-yn-1-yl)-3H-diazirin-3-yl)ethan-1-amine (0.175 mmol, 1.2 eq) and 0.073 ml DIEA (0.438 mmol, 3.0 eq) were added to the mixture, followed by stirring for another 12 h at room temperature. The mixture was then diluted with 20 ml H₂O, followed by extracting with 30 ml of DCM for 3 rounds. The organic phase obtained from the three rounds of extraction was pooled, dried by anhydrous Na₂SO₄ and then evaporated on a rotary evaporator (Rotavapor R-300, BUCHI) at 90 r.p.m. at room temperature. The powder was then dissolved in 1 ml DMSO, followed by purifying using preparative HPLC with the following gradients: t = 0 min, 50% solvent B (methanol) and 50% solvent A (H₂O); t = 15 min, 80% solvent B (methanol) and 2% solvent A (H₂O); t = 25 min, 100% B (methanol) and 0% solvent A (H₂O); t = 45 min, 100% B (methanol) and 0% solvent A (H₂O) with a constant flow rate at 20 ml min^–1. The LCA probe was obtained as a white solid with a yield of 80.7% (58.4 mg) and was dissolved in DMSO to a stock concentration of 50 mM. The solution was stored at 4 °C for no more than 1 month.

LCA probe: ¹H NMR (600 MHz, chloroform-d) δ 5.71 (t, J = 5.9 Hz, 1H), 3.62 (tt, J = 10.6, 4.6 Hz, 1H), 3.10 (q, J = 6.5 Hz, 2H), 2.24 (ddd, J = 14.5, 10.6, 5.1 Hz, 1H), 2.10–2.05 (m, 1H), 2.04–2.01 (m, 3H), 1.98–1.94 (m, 1H), 1.89–1.77 (m, 5H), 1.77–1.72 (m, 1H), 1.69 (t, J = 6.7 Hz, 2H), 1.67–1.63 (m, 3H), 1.60–1.54 (m, 1H), 1.53–1.48 (m, 1H), 1.44–1.35 (m, 6H), 1.35–1.29 (m, 2H), 1.28–1.19 (m, 3H), 1.17–1.12 (m, 1H), 1.09 (dd, J = 11.5, 7.8 Hz, 2H), 1.07–1.03 (m, 2H), 0.97 (td, J = 14.3, 3.5 Hz, 1H), 0.93 (d, J = 6.8 Hz, 3H), 0.92 (s, 3H), 0.64 (s, 3H); ¹³C NMR (151 MHz, chloroform-d) δ 173.7, 82.7, 71.8, 69.4, 56.5, 56.0, 42.8, 42.1, 40.5, 40.2, 36.5, 35.9, 35.5, 35.4, 34.6, 34.3, 33.6, 32.6, 32.2, 31.7, 30.6, 28.2, 27.2, 26.9, 26.4, 24.2, 23.4, 20.8, 18.4, 13.2, 12.1. MS (ESI) m/z: 496 [M + H]⁺. HRMS (ESI): [M + H]⁺ calculated for C₃₁H₅₀O₂N₃, 496.3898; found, 496.3910. HPLC analysis: retention time = 14.55 min; peak area, 98.02% (λ = 220 nm).

Protein expression

The cDNAs encoding human SIRT1, TULP3, ktub, tub-1 and mutants were inserted into pET-28a vectors for expressing His-tagged recombinant proteins. The pET-28a plasmids were transformed into the E. coli strain BL21 (DE3) (EC0114, Thermo), followed by culturing in LB medium in a shaker at 200 r.p.m. at 37 °C. The cultures of transformed cells were induced with 0.1 mM IPTG at an OD₆₀₀ of 1.0. After incubating for another 12 h at 160 r.p.m. at 16 °C, the cells were collected. Cells were then homogenized in a His-binding buffer (50 mM sodium phosphate, pH 7.0, 150 mM NaCl, 1% Triton X-100, 5% glycerol and 10 mM imidazole). The homogenates were then sonicated on ice and were subjected to ultracentrifugation at 150,000g for 30 min at 4 °C, followed by incubating with nickel affinity gel (pre-balanced with His-binding buffer). The nickel affinity gel was then washed with 100 times the volume of ice-cold His-washing buffer (50 mM sodium phosphate, pH 7.0, 150 mM NaCl and 20 mM imidazole), and the proteins were eluted from the resin with His-elution buffer (50 mM sodium phosphate, pH 7.0, 150 mM NaCl and 250 mM imidazole) at 4 °C. Proteins were then concentrated to approximately 3 mg ml^–1 by ultrafiltration (Millipore, UFC905096) at 4 °C, then purified by gel filtration on a Superdex 200 column (Cytiva) balanced with the Superdex buffer containing 50 mM Tris-HCl, pH 7.0 and 300 mM NaCl.

For determining the interaction between TULP3 and SIRT1 in vitro, the purified His-tagged TULP3 and SIRT1, 4 μg of each, were pre-incubated in 100 μl (final volume) of Superdex buffer on ice for 30 min. The mixtures were then placed into a Superdex 200 column balanced with Superdex buffer. The fraction size was set at 1 ml, with the mobile phase Superdex buffer and a flow rate of 0.5 ml min^–1. Samples were mixed with 5× SDS sample buffer, boiled and subjected to SDS–PAGE followed by Coomassie Brilliant Blue staining (see details in the section ‘Determination of the binding sites of TULP3 for LCA’) or IB.

Determination of the binding affinity of LCA to TULP3

To determine the binding affinity of LCA for TULP3 or SIRT1 using affinity pull-down assays, streptavidin magnetic beads bound with biotinylated LCA probe were first prepared (described in ref. ¹⁵, but with minor modifications). In brief, 10 μM LCA probe was dissolved in 100 μl ice-cold Triton lysis buffer at 4 °C, followed by mixing with 1 mM TCEP, 0.1 mM TBTA, 1 mM CuSO₄ and 1 mM biotin-N₃ linker (all final concentrations) at 4 °C for another 1 h. After centrifugation for 30 min at 20,000g, 4 °C, the supernatant was incubated with 10 μl streptavidin magnetic beads at 4 °C for 30 min, followed by washing with 100× volume of ice-cold Triton lysis buffer 3 times. The biotinylated LCA probe-bound beads were then incubated with 3 μg His-tagged TULP3, SIRT1 or TULP3–SIRT1 complex (prepared as described in the ‘Protein expression’ section) in 100 μl ice-cold Triton lysis buffer at 4 °C for 2 h, followed by washing with 100× volume of ice-cold Triton lysis buffer for 3 times and then incubating in 100 μl ice-cold Triton lysis buffer containing different concentrations of LCA at 4 °C for 0.5 h. The supernatants were then mixed with an equal volume of 2× SDS sample buffer, followed by IB to determine the amount of TULP3 or SIRT1 inside.

Determination of the binding sites of TULP3 for LCA

The binding sites of TULP3 for LCA were determined through a two-step approach using MS combined with silico docking assays, as previously described¹⁵. In brief, 10 μM LCA probe was incubated with 3 μg His-tagged TULP3 (purified as described in the section ‘Protein expression’) in 100 μl ice-cold Triton lysis buffer at 4 °C for 2 h and then exposed to 365-nm wavelength UV (CX-2000, UVP) for 10 min. The mixture was then adjusted to final concentrations of 1 mM TCEP, 0.1 mM TBTA, 1 mM CuSO₄ and 1 mM biotin-N₃ linker, and were incubated at 4 °C for another 1 h. Protein aggregates were cleared by centrifugation at 20,000 g for 15 min, and 10 μl streptavidin magnetic beads were then added to the supernatant for 2 h with gentle rotation. Beads were then washed with 100× volume of Triton lysis buffer for 3 times at 4 °C, followed by incubating in 100 μl ice-cold Triton lysis buffer containing different concentrations of LCA at 4 °C for 0.5 h. The supernatants were then mixed with an equal volume of 2× SDS sample buffer, followed by SDS–PAGE. After staining with Coomassie Brilliant Blue R-250 dye (5% (m/v) dissolved in 45% (v/v) methanol and 5% (v/v) acetic acid in water), gels were decoloured (in 45% (v/v) methanol and 5% (v/v) acetic acid in water), and the excised gel slices were subjected to in-gel chymotrypsin digestion and then dried. Samples were analysed using a nanoElute (Bruker) coupled to a timsTOF Pro (Bruker) equipped with a CaptiveSpray source. Peptides were dissolved in 10 μl of 0.1% formic acid (v/v) and were loaded onto a home-made C18 column (35 cm × 75 μm, i.d. of 1.9 μm, 100 Å). Samples were then eluted with linear gradients of 3–35% acetonitrile (v/v, in 0.1% formic acid) at a flow rate of 0.3 μl min^–1 for 60 min. MS data were acquired using a timsTOF Pro MS (Bruker) operated in PASEF mode, and data were analysed using Peaks Studio Xpro software (PEAKS Studio 10.6 build 20201221, Bioinformatics Solutions). The human UniProt Reference Proteome database was used for data analysis, during which the parameters were set as follows: precursor and fragment mass tolerances, 20 ppm and 0.05 Da; semi-specific digest mode, allowed; maximal missed cleavages per peptide, 3; variable modifications, oxidation of methionine, acetylation of protein amino termini and phosphorylation of serine, threonine and tyrosine; fixed modification, carbamidomethylation of cysteine, and 467.3763 for LCA modification.

According to the MS results, the cleft comprising amino acids S194 and K333 might constitute a binding site of TULP3 for LCA. The in silico docking assay was then performed using the AutoDock vina software¹³⁸ (v.1.1.2), during which the structure of LCA and the AlphaFold-predicted TULP3 structure (https://alphafold.ebi.ac.uk/entry/O75386)^139,140 were used. Data were then illustrated using PyMOL (ver. 2.5, Schrodinger) software. The amino acid residues Y193, P195, K333 and P336 of TULP3 were then mutated (all to glycine) to generate the TULP3(4G) mutant. Structural alignments were performed as described above, and the following structures, predicted by AlphaFold, were used: TULP3: https://alphafold.ebi.ac.uk/entry/O75386; ktub: https://alphafold.ebi.ac.uk/entry/Q86PC9; tub-1: https://alphafold.ebi.ac.uk/entry/Q09306; V1E2: https://alphafold.ebi.ac.uk/entry/Q96A05; and vha-8: https://alphafold.ebi.ac.uk/entry/Q95X44.

Determination of the thermal stability of TULP3

The thermal stability of TULP3 was determined by differential scanning calorimetry (DSC) assays performed on a VP-DSC as previously described¹⁵, but with minor modifications. In brief, the VP-DSC was run on a mode without feedback, and 15 min of equilibration at 10 °C was performed before and between each scan. The scanning range was set from 10 to 100 °C, and the heating rate at 90 °C h^–1. The instrument was pre-equilibrated by running for five heating–cooling cycles with both the sample cell and the reference cell loaded with His-elution buffer. The sample cell was then loaded with 350 μl of 50 μM His-tagged TULP3 protein or 30 μM His-tagged TULP3(4G) in the His-elution buffer, and curves of heat capacity (C_p) versus temperature were recorded. Data were collected using MicroCal VP-Capillary DSC software and were then corrected for His-elution buffer baselines and normalized for scan rate and protein concentration¹⁴¹ using Origin 2016.

Determination of SIRT1 activity

The deacetylase activity of SIRT1 was determined using a HPLC–MS-based method as previously described²⁷, but with some modifications. In brief, 4 μg of His-tagged SIRT1 or SIRT1(E230K) mutant (purified as described in the section ‘Protein expression’), either co-eluted with 4 μg of TULP3 or bound on 5 μl of nickel affinity gel and incubated with lysates collected from two 10-cm dishes of MEFs (at 60–70% confluence, lysed in 1 ml Triton lysis buffer as for IB) at 4 °C for 1 h and then washed with 1 ml Triton lysis buffer twice, was incubated in 45 μl of reaction buffer containing 50 mM Tris-HCl, pH 9.0, 4 mM MgCl₂, 0.2 mM DTT, 5 μM LCA (for LCA-treatment group only) and NAD⁺ at desired concentrations at 25 °C. The reaction was initiated by adding 5 μl acetylated histone H3 peptide (QTAR(AcK)STGG) or acetylated V1E1 peptide (LNEA(AcK)QRLS), both dissolved in the reaction buffer to a stock concentration of 2 μg μl^–1 to the mixture, followed by incubating at 25 °C for another 15 min. Next, 25 μl of 100% trichloroacetic acid and 50 μl distilled water were added to the mixture, and the mixture was incubated at −20 °C for 12 h, followed by centrifugation at 18,000g at 4 °C for 30 min. The pellets were dissolved with 70 μl of 10% (v/v, in water) acetonitrile, followed by vortexing for 30 s and then centrifuging at 18,000g at 4 °C for another 10 min. Next, 30 μl of supernatant was loaded into an injection vial (5182-0714, Agilent Technologies; with an insert (HM-1270, Zhejiang Hamag Technology)) equipped with a snap cap (HM-2076, Zhejiang Hamag Technology), and 4 μl of supernatant was injected into a HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC system (Agilent Technologies), which was interfaced with a 6545 MS (Agilent Technologies). The mobile phase consisted of 10 mM ammonium formate containing 0.1% (v/v) formic acid in LC–MS grade water (mobile phase A) and LC–MS grade acetonitrile containing 0.1% (v/v) formic acid (mobile phase B) and run at a flow rate of 0.3 ml min^–1. The HPLC gradient was as follows: 70% B for 1 min, then to 30% B at the 12th min, hold for 3 min, and then back to 70% B at the 15.4th min, hold for another 2 min. The parameters of 6545 MS (Agilent Technologies) were set as follows: ion source, Dual AJS ESI; polarity, positive; nozzle voltage, 500 V; fragmentor voltage, 175 V; skimmer voltage, 65 V; VCap, 500 V; drying gas (N₂) flow rate, 8 l min^–1; drying gas (N₂) temperature, 280 °C; nebulizer gas pressure, 35 psig; sheath gas temperature, 125 °C; sheath gas (N₂) flow rate, 11 l min^–1; and scanning range, 50–1,100 m/z. The deacetylated-to-acetylated peptide ratios of histone H3 and V1E1 were used to determine the activities of SIRT1 towards these substrates. The peak areas of each type of peptide were calculated using following m/z values: acetylated histone H3: 453.2403 + 905.4805; deacetylated histone H3: 453.2403 + 905.4805; acetylated V1E1: 550.8071 + 1100.6064; and deacetylated V1E1: 529.8019 + 1058.5959.

Measurement of v-ATPase activity in vitro

The ATP-dependent proton transport rates were measured using the initial rate of ATP-dependent fluorescent quenching of FITC–dextran, as previously described^12,142,143. In brief, lysosomes were loaded with FITC–dextran by incubating 60 10-cm dishes of MEFs (60–80% confluence) in DMEM supplemented with 2 mg ml^–1 FITC–dextran (final concentration) on ice for 5 min, then transferring to a 37 °C incubator for 30 min. Cells were washed with DMEM for 3 times and incubated with DMEM for another 30 min at 37 °C to allow transport of FITC–dextran to lysosomes. Cells were then collected by directly scraping at room temperature, followed by centrifugation for 5 min at 500g at 37 °C, and lysosomes were purified using a lysosome isolation kit according to the manufacturer’s instructions, but with minor modifications¹⁵. In brief, cells were resuspended in 7 ml of 1× extraction buffer containing protease inhibitor cocktail at room temperature and were dounced in a 7-ml dounce homogenizer (Sigma, P0610) for 120 strokes on ice followed by centrifugation for 10 min at 1,000g, 4 °C, which produced post-nuclear supernatant (PNS). The PNS was then centrifuged for 20 min at 20,000g and the pellet was suspended in 1× extraction buffer by gentle pipetting, generating the crude lysosomal fraction (CLF). The volume of CLF was adjusted to 2.4 ml and then equally divided into six 1.5-ml Eppendorf tubes (400 μl per tube). A volume of 253 μl of OptiPrep and 137 μl of 1× OptiPrep dilution buffer were added to each CLF, and mixed by gentle pipetting. The mixture is defined as the diluted OptiPrep fraction (DOF). Each DOF (0.8 ml) was loaded into an 11 × 60 mm centrifuge tube at the top of 27% (0.4 ml) and 22.5% (0.5 ml) OptiPrep solution cushions, and then overlaid with 16% (1 ml), 12% (0.9 ml) and 8% (0.3 ml) OptiPrep solutions. The tube was then centrifuged on a SW60 Ti rotor (Beckman) at 150,000g for 4 h at 4 °C, and the fraction at the top of 12% OptiPrep solution was collected as the CLF. The fraction was diluted with two volumes of PBS, followed by centrifugation at 20,000g for 20 min. The supernatant was then aspirated, and the sediment was resuspended in assay buffer (125 mM KCl, 1 mM EDTA, 20 mM HEPES, pH 7.5, with KOH) and was balanced on ice for 1 h, then mixed with 5 μM ConA (for calculating the v-ATPase-specific proton transport rates) or DMSO, then warmed at 37 °C for 10 min. The fluorescence of FITC was recorded with excitation at 490 nm and emission at 520 nm using a SpectraMax M5 microplate reader. The initial slope of fluorescence quenching was measured after the addition of 5 mM Mg-ATP (final concentration).

Purification of mitochondria and cytosol

Mitochondria were purified as previously described¹⁴⁴, but with minor modifications¹⁶. In brief, 40 10-cm dishes of MEFs (60–80% confluence) were collected by scraping at room temperature, followed by centrifugation for 5 min at 500g at 37 °C. Cells were then resuspended in 20 ml ice-cold IB_cells-1 buffer (225 mM mannitol, 75 mM sucrose, 0.1 mM EGTA and 30 mM Tris-HCl, pH 7.4) and dounced for 100 strokes in a 40-ml dounce homogenizer (using a small clearance pestle, or pestle B; D9188, Sigma), followed by 2 times of centrifugation for 5 min at 600g at 4 °C. The supernatants were then collected and centrifuged for 10 min at 7,000g at 4 °C. The pellets were then washed twice with 20 ml ice-cold IB_cells-2 buffer (225 mM mannitol, 75 mM sucrose and 30 mM Tris-HCl pH 7.4). The suspensions were centrifuged at 7,000g, and again at 10,000g, both for 10 min at 4 °C. The pellets were then resuspended in 2 ml ice-cold MRB buffer (250 mM mannitol, 5 mM HEPES, pH 7.4 and 0.5 mM EGTA) and were loaded on top of 10 ml of Percoll medium (225 mM mannitol, 25 mM HEPES pH 7.4, 1 mM EGTA and 30% Percoll (v/v)) in 14 × 89-mm centrifuge tubes (344059, Beckman). The tubes were then centrifuged in a SW 41 Ti rotor (Beckman) at 95,000g for 0.5 h at 4 °C. After centrifugation, the dense band located near the bottom of each tube was collected as the mitochondrial fraction. The mitochondrial fractions were diluted with 10 volumes of MRB buffer, followed by centrifugation at 6,300g for 10 min at 4 °C. The pellets were resuspended and washed with 2 ml of MRB buffer, followed by centrifugation at 6,300g for 10 min at 4 °C to obtain pure mitochondria (the pellets).

Cytosol was purified as previously described¹⁴⁵. In brief, ten 10-cm dishes of cells were homogenized in 800 μl homogenization buffer (HB; 250 mM sucrose and 3 mM imidazole, pH 7.4). Homogenates were then passed through a 22 G needle attached to a 1-ml syringe 6 times and were then centrifuged at 2,000g for 10 min to produce PNS. PNS samples were then loaded onto the top of 11 × 60-mm centrifuge tubes that had been sequentially loaded with 1 ml of 40.6% sucrose (dissolved in HB), 1 ml of 35% sucrose (dissolved in HB) and 1 ml of 25% sucrose (dissolved in HB). Tubes were then centrifuged in a SW60 Ti rotor (Beckman) at 35,000 r.p.m. for 1 h at 4 °C, and the top fractions (about 200 μl) were collected as cytosolic fractions.

Protein and peptide MS

To determine the modifications of v-ATPase, the 21 HA-tagged subunits of v-ATPase, including ATP6V1A, ATP6V1B2, ATP6V1C1, ATP6V1C2, ATP6V1D, ATP6V1E1, ATP6V1E2, ATP6V1F, ATP6V1G1, ATP6V1G2, ATP6V1G3, ATP6V1H, ATP6V0A4, ATP6V0A2, ATP6V0B, ATP6V0C, ATP6V0D1, ATP6V0D2, ATP6V0E1, ATP6AP1 and ATP6AP2, were individually expressed in HEK293T cells. The immunoprecipitants (immunoprecipitated from 25 10-cm dishes of HEK293T cells ectopically expressing a certain subunit) were subjected to SDS–PAGE and were processed as described in the section ‘Determination of the binding sites of TULP3 for LCA’. Samples were analysed using a nanoElute (Bruker) coupled to a timsTOF Pro (Bruker) equipped with a CaptiveSpray source. Peptides were dissolved in 10 μl of 0.1% formic acid (v/v) and were loaded onto a home-made C18 column (35 cm × 75 μm, i.d. of 1.9 μm, 100 Å). Samples were then eluted with linear gradients of 3–35% acetonitrile (v/v, in 0.1% formic acid) at a flow rate of 0.3 μl min^–1 for 60 min. MS data were acquired using a timsTOF Pro MS (Bruker) operated in PASEF mode, and were analysed using Peaks Studio Xpro (PEAKS Studio 10.6 build 20201221, Bioinformatics Solutions). The human UniProt Reference Proteome database was used for data analysis, during which the parameters were set as follows: precursor and fragment mass tolerances, 20 ppm and 0.05 Da; semi-specific digest mode, allowed; maximal missed cleavages per peptide, 3; variable modifications, oxidation of methionine, acetylation of protein amino termini, phosphorylation of serine, threonine and tyrosine, and acetylation of lysine; fixed modification, carbamidomethylation of cysteine.

To identify SIRT1-interacting proteins, HA-tagged SIRT1 immunoprecipitants (immunoprecipitated from 20 10-cm dishes of MEFs stably expressing HA-tagged SIRT1) were subjected to SDS–PAGE and were processed as described above. Data acquisition was performed as described above, except that an EASY-nLC 1200 System (Thermo) coupled to an Orbitrap Fusion Lumos Tribrid spectrometer (Thermo) equipped with an EASY-Spray Nanosource was used. Data were analysed using Proteome Discoverer (v.2.2, Thermo) against the mouse UniProt Reference Proteome database.

Protein levels of each bile acid receptor expressed in MEFs, as shown in Extended Data Fig. 9 and Supplementary Table 4, were quantified by using parallel reaction monitoring (PRM)-based MS. In brief, each bile acid receptor was individually expressed in HEK293T cells, followed by SDS–PAGE and processing as described above. Data acquisition was performed using an Orbitrap Fusion Lumos Tribrid spectrometer (Thermo) equipped with an EASY-Spray Nanosource in data-dependent acquisition mode. Peptides were eluted for 120 min with linear gradients of 3–35% acetonitrile in 0.1% formic acid at a flow rate of 300 nl min^–1. The data-dependent acquisition raw files were analysed using Proteome Discoverer software (v.2.5, Thermo), with the UniProt database (Mus musculus) utilized, and the quantotypic peptides for each bile acid receptor chosen accordingly (as shown in Supplementary Table 4). Protein levels of endogenous bile acid receptors were then determined through PRM analysis on the same spectrometer using samples prepared from MEFs, with the m/z, z and start/stop time of each quantotypic peptide applied. During data collection, the automatic gain control was set at 1 × 10⁵, the maximum injection time at 1,000 ms, and the precursor isolation window width of m/z at 1 (complete parameter set available in the source data files deposited in the iProX partner repository along with the paper). The PRM data were analysed using Skyline-daily software (21.2.1.424) as previously described¹⁴⁶.

Determination of OCRs

The OCRs of nematodes was measured as previously described¹⁴⁷. In brief, nematodes were washed with M9 buffer for 3 times. About 15–25 nematodes were suspended in 200 μl M9 buffer and were added to a well on a 96-well Seahorse XF cell culture microplate. Measurements were performed using a Seahorse XFe96 Analyzer (Agilent Technologies) at 20 °C following the manufacturer’s instruction, with a Seahorse XFe96 sensor cartridge (Agilent Technologies) pre-equilibrated in Seahorse XF calibrant solution in a CO₂-free incubator at 37 °C overnight. Concentrations of respiratory chain inhibitors used during the assay were as follows: FCCP at 10 μM and sodium azide at 40 mM. At the end of the assay, the exact number of nematodes in each well was determined on a Cell Imaging Multi-Mode reader (Cytation 1, BioTek) and was used for normalizing and correcting OCR results. Data were collected using Wave 2.6.1 Desktop software (Agilent Technologies) and exported to Prism 9 (GraphPad) for further analysis according to the manufacturer’s instructions.

The OCRs of intact muscle tissue was measured as previously described^86,148, but with modifications. In brief, mice were starved for desired durations and were killed through cervical dislocation. The gastrocnemius muscles from two hindlegs were then excised, followed by incubating in 4 ml dissociation medium (DM; by dissolving 50 μg ml^–1 gentamycin, 2% (v/v) FBS, 4 mg ml^–1 collagenase A in DMEM containing HEPES) in a 35-mm culture dish in a humidified chamber at 37 °C, 5% CO₂ for 1.5 h. The digested muscle masses were then washed with 4 ml pre-warmed collagenase A-free DM, incubated in 0.5 ml of pre-warmed collagenase A-free DM and dispersed by passing through a 20 G needle 6 times. Next, 20 μl of muscle homogenate was transferred to a well of a Seahorse XF24 Islet capture microplate (Agilent Technologies). After placing an islet capture screen by a Seahorse Capture Screen Insert Tool (Agilent Technologies) into the well, 480 μl pre-warmed aCSF medium (120 mM NaCl, 3.5 mM KCl, 1.3 mM CaCl₂, 0.4 mM KH₂PO₄, 1 mM MgCl₂, 5 mM HEPES, 15 mM glucose, 1× MEM non-essential amino acids, 1 mM sodium pyruvate and 1 mM GlutaMAX; adjust to pH 7.4 before use) was added, followed by equilibrating in a CO₂-free incubator at 37 °C for 1 h. OCR was then measured at 37 °C in an XFe24 Extracellular Flux analyzer (Agilent Technologies), with a Seahorse XFe24 sensor cartridge (Agilent Technologies) pre-equilibrated in Seahorse XF calibrant solution (Agilent Technologies) in a CO₂-free incubator at 37 °C overnight. The respiratory chain inhibitor used during the assay was oligomycin at 10 μM of final concentration. Data were collected using Wave 2.6.3 Desktop software (Agilent Technologies) and exported to Prism 9 (GraphPad) for further analysis according to the manufacturer’s instructions.

Statistical analysis

Statistical analyses were performed using Prism 9 (GraphPad Software), except for the survival curves, which were analysed using SPSS 27.0 (IBM) by log-rank (Mantel–Cox) test. Each group of data was subjected to Kolmogorov–Smirnov tests, Anderson–Darling tests, D’Agostino–Pearson omnibus tests or Shapiro–Wilk tests for normal distribution when applicable. An unpaired two-sided Student’s t-test was used to determine the significance between two groups of normally distributed data. Welch’s correction was used for groups with unequal variances. An unpaired two-sided Mann–Whitney test was used to determine the significance between data without a normal distribution. For comparisons between multiple groups with a fixed factor, an ordinary one-way ANOVA was used, followed by Tukey’s, Sidak’s, Dunnett’s or Dunn’s test as specified in the legends. The assumptions of homogeneity of error variances were tested using F-test (P > 0.05). For comparison between multiple groups with two fixed factors, an ordinary two-way ANOVA was used, followed by Tukey’s or Sidak’s multiple comparisons test as specified in the legends. Geisser–Greenhouse’s correction was used where applicable. The adjusted means and s.e.m. or s.d. values were recorded when the analysis met the above standards. Differences were considered significant when P < 0.05 or P > 0.05 with large differences of observed effects (as suggested in refs. ^149,150).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.